Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624250_at:

>probe:Drosophila_2:1624250_at:620:549; Interrogation_Position=3931; Antisense; GGAGTACTCCTTCAACTGGATGGAA
>probe:Drosophila_2:1624250_at:234:587; Interrogation_Position=3947; Antisense; TGGATGGAACTGATTCCCAGGCCCA
>probe:Drosophila_2:1624250_at:698:267; Interrogation_Position=3964; Antisense; CAGGCCCACACTGAGCATGGCGGAG
>probe:Drosophila_2:1624250_at:580:555; Interrogation_Position=3988; Antisense; GGACTGCCAGTTTAAGTGTGCCGAA
>probe:Drosophila_2:1624250_at:509:623; Interrogation_Position=4006; Antisense; TGCCGAATTGGGTGCCTGTGTAAAT
>probe:Drosophila_2:1624250_at:328:513; Interrogation_Position=4044; Antisense; GTGATGGTGTAGTCCACTGTCCTTC
>probe:Drosophila_2:1624250_at:63:139; Interrogation_Position=4074; Antisense; ACGATGAGACCTTCCTGCAGTGTTC
>probe:Drosophila_2:1624250_at:546:719; Interrogation_Position=4085; Antisense; TTCCTGCAGTGTTCAGCCTTGATGA
>probe:Drosophila_2:1624250_at:572:125; Interrogation_Position=4099; Antisense; AGCCTTGATGAAACTGCCCGCCGAG
>probe:Drosophila_2:1624250_at:641:645; Interrogation_Position=4143; Antisense; TCATCTTTGTGCTCTCGTGTTGTGC
>probe:Drosophila_2:1624250_at:29:617; Interrogation_Position=4224; Antisense; TGCAGACGCGACTCAAATCGCTGAG
>probe:Drosophila_2:1624250_at:39:237; Interrogation_Position=4239; Antisense; AATCGCTGAGCTCGATGGACACGGC
>probe:Drosophila_2:1624250_at:485:585; Interrogation_Position=4254; Antisense; TGGACACGGCCGTTCTGGATGAAAA
>probe:Drosophila_2:1624250_at:430:193; Interrogation_Position=4435; Antisense; AACTCTTCTTCCTTTTCAAGAACTG

Paste this into a BLAST search page for me
GGAGTACTCCTTCAACTGGATGGAATGGATGGAACTGATTCCCAGGCCCACAGGCCCACACTGAGCATGGCGGAGGGACTGCCAGTTTAAGTGTGCCGAATGCCGAATTGGGTGCCTGTGTAAATGTGATGGTGTAGTCCACTGTCCTTCACGATGAGACCTTCCTGCAGTGTTCTTCCTGCAGTGTTCAGCCTTGATGAAGCCTTGATGAAACTGCCCGCCGAGTCATCTTTGTGCTCTCGTGTTGTGCTGCAGACGCGACTCAAATCGCTGAGAATCGCTGAGCTCGATGGACACGGCTGGACACGGCCGTTCTGGATGAAAAAACTCTTCTTCCTTTTCAAGAACTG

Full Affymetrix probeset data:

Annotations for 1624250_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime