Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624251_a_at:

>probe:Drosophila_2:1624251_a_at:511:189; Interrogation_Position=115; Antisense; AACATGTCCGCCTACAAGCTGGAGA
>probe:Drosophila_2:1624251_a_at:178:341; Interrogation_Position=182; Antisense; GCTACTGCTACCAGTCGTACATCGA
>probe:Drosophila_2:1624251_a_at:575:223; Interrogation_Position=265; Antisense; AAGGTCTACAAGTCGATGTGCCCCA
>probe:Drosophila_2:1624251_a_at:159:623; Interrogation_Position=283; Antisense; TGCCCCAACGCCTGGGTGGAGAAGT
>probe:Drosophila_2:1624251_a_at:291:103; Interrogation_Position=362; Antisense; AGACGCAGCAACACAGTAAACCCAG
>probe:Drosophila_2:1624251_a_at:504:323; Interrogation_Position=442; Antisense; GCGTGGTAACCAGAATCCGGCAATT
>probe:Drosophila_2:1624251_a_at:562:403; Interrogation_Position=475; Antisense; GACTAGTTTGTGTTTGTGCTTTCCC
>probe:Drosophila_2:1624251_a_at:192:729; Interrogation_Position=488; Antisense; TTGTGCTTTCCCCAGCGGTGAATGC
>probe:Drosophila_2:1624251_a_at:665:509; Interrogation_Position=505; Antisense; GTGAATGCAGACCATCATCGGCAAA
>probe:Drosophila_2:1624251_a_at:413:363; Interrogation_Position=565; Antisense; GAATTCTGAACCGATCGTTTGTGTT
>probe:Drosophila_2:1624251_a_at:348:515; Interrogation_Position=585; Antisense; GTGTTTGTTTCTTCTTGATCCTTGA
>probe:Drosophila_2:1624251_a_at:129:727; Interrogation_Position=599; Antisense; TTGATCCTTGATCCTTGATCCTTGA
>probe:Drosophila_2:1624251_a_at:612:603; Interrogation_Position=614; Antisense; TGATCCTTGATTCTTGGTCCTGCCG
>probe:Drosophila_2:1624251_a_at:233:577; Interrogation_Position=644; Antisense; GGCCGAACTGGCATCCGAATCAGAT

Paste this into a BLAST search page for me
AACATGTCCGCCTACAAGCTGGAGAGCTACTGCTACCAGTCGTACATCGAAAGGTCTACAAGTCGATGTGCCCCATGCCCCAACGCCTGGGTGGAGAAGTAGACGCAGCAACACAGTAAACCCAGGCGTGGTAACCAGAATCCGGCAATTGACTAGTTTGTGTTTGTGCTTTCCCTTGTGCTTTCCCCAGCGGTGAATGCGTGAATGCAGACCATCATCGGCAAAGAATTCTGAACCGATCGTTTGTGTTGTGTTTGTTTCTTCTTGATCCTTGATTGATCCTTGATCCTTGATCCTTGATGATCCTTGATTCTTGGTCCTGCCGGGCCGAACTGGCATCCGAATCAGAT

Full Affymetrix probeset data:

Annotations for 1624251_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime