Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624253_at:

>probe:Drosophila_2:1624253_at:55:623; Interrogation_Position=1026; Antisense; TGCGGTGGTCCAGGTGACTTTTTTA
>probe:Drosophila_2:1624253_at:196:167; Interrogation_Position=1094; Antisense; AAATCCTGCCCAACTGGTATCGAGA
>probe:Drosophila_2:1624253_at:720:95; Interrogation_Position=1116; Antisense; AGATTTGCTCAAAACGCGCTCCTAA
>probe:Drosophila_2:1624253_at:254:217; Interrogation_Position=544; Antisense; AAGTTCGAGCAGTACCTGACCAGTG
>probe:Drosophila_2:1624253_at:524:93; Interrogation_Position=620; Antisense; AGTTCATGGGCGTGTACCGCACGAA
>probe:Drosophila_2:1624253_at:715:379; Interrogation_Position=642; Antisense; GAACCTGGCCGGGATTTTGATGCTA
>probe:Drosophila_2:1624253_at:123:703; Interrogation_Position=656; Antisense; TTTTGATGCTATACGGCGCCGAACT
>probe:Drosophila_2:1624253_at:183:465; Interrogation_Position=718; Antisense; GATTGCAGAGTGCTCGACTCATTGA
>probe:Drosophila_2:1624253_at:67:499; Interrogation_Position=766; Antisense; GTCTTCAATATGAACCCTCACCAAA
>probe:Drosophila_2:1624253_at:322:163; Interrogation_Position=788; Antisense; AAATTCGCACCTTCAAATCGTTCAA
>probe:Drosophila_2:1624253_at:208:237; Interrogation_Position=803; Antisense; AATCGTTCAAGTCTGCCAACTGGTG
>probe:Drosophila_2:1624253_at:244:89; Interrogation_Position=829; Antisense; AGTCAGTCATTCCTGGTGGGCATCA
>probe:Drosophila_2:1624253_at:660:39; Interrogation_Position=951; Antisense; ATCGGCAATGGCTTGGTACCTGGAA
>probe:Drosophila_2:1624253_at:33:489; Interrogation_Position=966; Antisense; GTACCTGGAACAGTTTCTGCGCAAT

Paste this into a BLAST search page for me
TGCGGTGGTCCAGGTGACTTTTTTAAAATCCTGCCCAACTGGTATCGAGAAGATTTGCTCAAAACGCGCTCCTAAAAGTTCGAGCAGTACCTGACCAGTGAGTTCATGGGCGTGTACCGCACGAAGAACCTGGCCGGGATTTTGATGCTATTTTGATGCTATACGGCGCCGAACTGATTGCAGAGTGCTCGACTCATTGAGTCTTCAATATGAACCCTCACCAAAAAATTCGCACCTTCAAATCGTTCAAAATCGTTCAAGTCTGCCAACTGGTGAGTCAGTCATTCCTGGTGGGCATCAATCGGCAATGGCTTGGTACCTGGAAGTACCTGGAACAGTTTCTGCGCAAT

Full Affymetrix probeset data:

Annotations for 1624253_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime