FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624256_at:

>probe:Drosophila_2:1624256_at:272:97; Interrogation_Position=2150; Antisense; AGAGACCTTCGACAACTACTACCAG
>probe:Drosophila_2:1624256_at:604:395; Interrogation_Position=2193; Antisense; GACACACTGTTCAAGGTGCAGGTCC
>probe:Drosophila_2:1624256_at:706:43; Interrogation_Position=2268; Antisense; ATCGACGTGCCATCGCAGCGTAAAG
>probe:Drosophila_2:1624256_at:362:171; Interrogation_Position=2289; Antisense; AAAGTGCGGGCCCTGATCATCGGCA
>probe:Drosophila_2:1624256_at:426:647; Interrogation_Position=2305; Antisense; TCATCGGCAGTTCCGTGGGCGTCAT
>probe:Drosophila_2:1624256_at:488:321; Interrogation_Position=2343; Antisense; GCCCTGTGCGCTTTTTTATACGTGA
>probe:Drosophila_2:1624256_at:709:507; Interrogation_Position=2364; Antisense; GTGAAGCGGAGCTGCCTAAGGCATC
>probe:Drosophila_2:1624256_at:145:41; Interrogation_Position=2386; Antisense; ATCTGTTCGCCAAGGATAGCTCCGC
>probe:Drosophila_2:1624256_at:539:87; Interrogation_Position=2497; Antisense; AGTCCACCTGAGGATTGCTCCAGAT
>probe:Drosophila_2:1624256_at:308:97; Interrogation_Position=2518; Antisense; AGATCCGCTGGCGATTTGACAGCAA
>probe:Drosophila_2:1624256_at:631:397; Interrogation_Position=2535; Antisense; GACAGCAACCATGTTGGCCAGTGAA
>probe:Drosophila_2:1624256_at:313:229; Interrogation_Position=2582; Antisense; AATGGGTGGGTTGTTCACCGTGCAC
>probe:Drosophila_2:1624256_at:425:509; Interrogation_Position=2601; Antisense; GTGCACCAGTCCGTGGGAATCTGAC
>probe:Drosophila_2:1624256_at:208:499; Interrogation_Position=2637; Antisense; GTCTAGCTGCTATCTGTAACATAAA

Paste this into a BLAST search page for me
AGAGACCTTCGACAACTACTACCAGGACACACTGTTCAAGGTGCAGGTCCATCGACGTGCCATCGCAGCGTAAAGAAAGTGCGGGCCCTGATCATCGGCATCATCGGCAGTTCCGTGGGCGTCATGCCCTGTGCGCTTTTTTATACGTGAGTGAAGCGGAGCTGCCTAAGGCATCATCTGTTCGCCAAGGATAGCTCCGCAGTCCACCTGAGGATTGCTCCAGATAGATCCGCTGGCGATTTGACAGCAAGACAGCAACCATGTTGGCCAGTGAAAATGGGTGGGTTGTTCACCGTGCACGTGCACCAGTCCGTGGGAATCTGACGTCTAGCTGCTATCTGTAACATAAA

Full Affymetrix probeset data:

Annotations for 1624256_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720