Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624257_at:

>probe:Drosophila_2:1624257_at:542:701; Interrogation_Position=1593; Antisense; TTTTCTCATCATTTTCATCATCTCC
>probe:Drosophila_2:1624257_at:606:271; Interrogation_Position=1599; Antisense; CATCATTTTCATCATCTCCGTAGTA
>probe:Drosophila_2:1624257_at:685:645; Interrogation_Position=1610; Antisense; TCATCTCCGTAGTATTTAGTTCAAC
>probe:Drosophila_2:1624257_at:709:45; Interrogation_Position=1681; Antisense; ATCCAGCGTATGTTCAGAAAACCAG
>probe:Drosophila_2:1624257_at:476:357; Interrogation_Position=1757; Antisense; GCAAATTCTGGCATATCTGTCCACT
>probe:Drosophila_2:1624257_at:576:569; Interrogation_Position=1766; Antisense; GGCATATCTGTCCACTTCAGTATTC
>probe:Drosophila_2:1624257_at:156:661; Interrogation_Position=1781; Antisense; TTCAGTATTCAGTATTAGGTGGCTA
>probe:Drosophila_2:1624257_at:221:171; Interrogation_Position=1825; Antisense; AAAGTAATTCATCAGTCCCACTATA
>probe:Drosophila_2:1624257_at:439:265; Interrogation_Position=1837; Antisense; CAGTCCCACTATATACACAATTAAA
>probe:Drosophila_2:1624257_at:520:455; Interrogation_Position=1873; Antisense; GATAATGATTTTGCATCCGCTCTTG
>probe:Drosophila_2:1624257_at:44:347; Interrogation_Position=1885; Antisense; GCATCCGCTCTTGAAATTTGGTATT
>probe:Drosophila_2:1624257_at:651:641; Interrogation_Position=1919; Antisense; TCTTTTACCTTTTTTGAATGACACT
>probe:Drosophila_2:1624257_at:258:437; Interrogation_Position=1970; Antisense; GAGGACCCAGTAATGTTACAATTGC
>probe:Drosophila_2:1624257_at:125:553; Interrogation_Position=2065; Antisense; GGAGCAGTTTGGTAAGCAGTTAAGA

Paste this into a BLAST search page for me
TTTTCTCATCATTTTCATCATCTCCCATCATTTTCATCATCTCCGTAGTATCATCTCCGTAGTATTTAGTTCAACATCCAGCGTATGTTCAGAAAACCAGGCAAATTCTGGCATATCTGTCCACTGGCATATCTGTCCACTTCAGTATTCTTCAGTATTCAGTATTAGGTGGCTAAAAGTAATTCATCAGTCCCACTATACAGTCCCACTATATACACAATTAAAGATAATGATTTTGCATCCGCTCTTGGCATCCGCTCTTGAAATTTGGTATTTCTTTTACCTTTTTTGAATGACACTGAGGACCCAGTAATGTTACAATTGCGGAGCAGTTTGGTAAGCAGTTAAGA

Full Affymetrix probeset data:

Annotations for 1624257_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime