FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624259_at:

>probe:Drosophila_2:1624259_at:277:305; Interrogation_Position=368; Antisense; CCGGGCAAATGCTCTCCAATATGTT
>probe:Drosophila_2:1624259_at:10:555; Interrogation_Position=424; Antisense; GGAGCCCTAGCCTTAAATGCATTGA
>probe:Drosophila_2:1624259_at:629:467; Interrogation_Position=454; Antisense; GTTGCTCAGGCGATTGGTAGCTCCC
>probe:Drosophila_2:1624259_at:527:563; Interrogation_Position=525; Antisense; GGAATCCCTGTATGAACCCAGCGAT
>probe:Drosophila_2:1624259_at:61:45; Interrogation_Position=576; Antisense; ATCGCCCATCGATTGGTTTATGCAA
>probe:Drosophila_2:1624259_at:125:663; Interrogation_Position=594; Antisense; TATGCAACGTACAGATCGCTATAGC
>probe:Drosophila_2:1624259_at:667:529; Interrogation_Position=647; Antisense; GGGATTTGCCCGACTACATACTAGA
>probe:Drosophila_2:1624259_at:610:171; Interrogation_Position=707; Antisense; AAACCGCTGGTTGCCTAAAGCTTCT
>probe:Drosophila_2:1624259_at:413:341; Interrogation_Position=726; Antisense; GCTTCTGATGTGCAAGGGTCAACCA
>probe:Drosophila_2:1624259_at:448:423; Interrogation_Position=794; Antisense; GAGAACCTGAAGAGCCCGATGATAA
>probe:Drosophila_2:1624259_at:383:319; Interrogation_Position=807; Antisense; GCCCGATGATAACGATAGCTACTTT
>probe:Drosophila_2:1624259_at:658:661; Interrogation_Position=849; Antisense; TAAACACTTGCCCAGTCTTGAGGAT
>probe:Drosophila_2:1624259_at:251:381; Interrogation_Position=879; Antisense; GAACCATAGTGCTAGCTGTGAAGTC
>probe:Drosophila_2:1624259_at:587:163; Interrogation_Position=904; Antisense; AAATACCACGAGGAGTGCCCCAAGA

Paste this into a BLAST search page for me
CCGGGCAAATGCTCTCCAATATGTTGGAGCCCTAGCCTTAAATGCATTGAGTTGCTCAGGCGATTGGTAGCTCCCGGAATCCCTGTATGAACCCAGCGATATCGCCCATCGATTGGTTTATGCAATATGCAACGTACAGATCGCTATAGCGGGATTTGCCCGACTACATACTAGAAAACCGCTGGTTGCCTAAAGCTTCTGCTTCTGATGTGCAAGGGTCAACCAGAGAACCTGAAGAGCCCGATGATAAGCCCGATGATAACGATAGCTACTTTTAAACACTTGCCCAGTCTTGAGGATGAACCATAGTGCTAGCTGTGAAGTCAAATACCACGAGGAGTGCCCCAAGA

Full Affymetrix probeset data:

Annotations for 1624259_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720