FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624260_at:

>probe:Drosophila_2:1624260_at:324:367; Interrogation_Position=252; Antisense; GAATCTGCCCAGAGCGGTCAAATTT
>probe:Drosophila_2:1624260_at:154:331; Interrogation_Position=318; Antisense; GCGGGTCTCTAATCAATGCTTGCAG
>probe:Drosophila_2:1624260_at:311:283; Interrogation_Position=357; Antisense; CTGCGTGAATACGTTCCTCTACAAG
>probe:Drosophila_2:1624260_at:524:521; Interrogation_Position=387; Antisense; GGGCGAGTCCTCAGATTTCGTCAAG
>probe:Drosophila_2:1624260_at:111:107; Interrogation_Position=416; Antisense; AGAACACTTCCAAGGGCTTCAACGT
>probe:Drosophila_2:1624260_at:434:343; Interrogation_Position=431; Antisense; GCTTCAACGTGATCAGCTTCCTGAA
>probe:Drosophila_2:1624260_at:699:263; Interrogation_Position=444; Antisense; CAGCTTCCTGAATATGTGGTTCGAA
>probe:Drosophila_2:1624260_at:712:671; Interrogation_Position=469; Antisense; TACCACAAGATGATGAAGCCCAGCT
>probe:Drosophila_2:1624260_at:203:387; Interrogation_Position=498; Antisense; GAACAACTTTCCCAATATAGCCCCT
>probe:Drosophila_2:1624260_at:58:79; Interrogation_Position=524; Antisense; AGGATCGGCTCATTATCTTCGCCAA
>probe:Drosophila_2:1624260_at:440:15; Interrogation_Position=535; Antisense; ATTATCTTCGCCAATCTGATCTACG
>probe:Drosophila_2:1624260_at:68:285; Interrogation_Position=613; Antisense; CTGACCTGCCTCTTCGATAAGAAAA
>probe:Drosophila_2:1624260_at:70:377; Interrogation_Position=651; Antisense; GAAGCTTTACACCACTCGGTTGAAT
>probe:Drosophila_2:1624260_at:207:367; Interrogation_Position=672; Antisense; GAATGATCCATTTCGCACAAATCGG

Paste this into a BLAST search page for me
GAATCTGCCCAGAGCGGTCAAATTTGCGGGTCTCTAATCAATGCTTGCAGCTGCGTGAATACGTTCCTCTACAAGGGGCGAGTCCTCAGATTTCGTCAAGAGAACACTTCCAAGGGCTTCAACGTGCTTCAACGTGATCAGCTTCCTGAACAGCTTCCTGAATATGTGGTTCGAATACCACAAGATGATGAAGCCCAGCTGAACAACTTTCCCAATATAGCCCCTAGGATCGGCTCATTATCTTCGCCAAATTATCTTCGCCAATCTGATCTACGCTGACCTGCCTCTTCGATAAGAAAAGAAGCTTTACACCACTCGGTTGAATGAATGATCCATTTCGCACAAATCGG

Full Affymetrix probeset data:

Annotations for 1624260_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720