FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624262_at:

>probe:Drosophila_2:1624262_at:729:101; Interrogation_Position=1381; Antisense; ACCAAAATTCCCACCAAGCTTCAAT
>probe:Drosophila_2:1624262_at:36:127; Interrogation_Position=1393; Antisense; ACCAAGCTTCAATCCAACTCGCTGG
>probe:Drosophila_2:1624262_at:39:195; Interrogation_Position=1408; Antisense; AACTCGCTGGCCTGCGATTACCAAT
>probe:Drosophila_2:1624262_at:277:327; Interrogation_Position=1421; Antisense; GCGATTACCAATGGGCCTTAGCATT
>probe:Drosophila_2:1624262_at:591:315; Interrogation_Position=1435; Antisense; GCCTTAGCATTAGCCTCGTCTAAAA
>probe:Drosophila_2:1624262_at:177:199; Interrogation_Position=1459; Antisense; AACGATGGGTCCAATTGATGCCCCG
>probe:Drosophila_2:1624262_at:538:447; Interrogation_Position=1475; Antisense; GATGCCCCGCACACAAAATAGTCAA
>probe:Drosophila_2:1624262_at:90:675; Interrogation_Position=1493; Antisense; TAGTCAAATTGCATGCACAATACGC
>probe:Drosophila_2:1624262_at:338:357; Interrogation_Position=1507; Antisense; GCACAATACGCAAATTATGAGCATT
>probe:Drosophila_2:1624262_at:667:467; Interrogation_Position=1545; Antisense; GTTAATAGTACCTCGATTACATTTT
>probe:Drosophila_2:1624262_at:394:135; Interrogation_Position=1690; Antisense; ACATATTAGTCGTAGGCAAATCCCT
>probe:Drosophila_2:1624262_at:298:659; Interrogation_Position=1702; Antisense; TAGGCAAATCCCTGACTTACCCAAA
>probe:Drosophila_2:1624262_at:709:171; Interrogation_Position=1739; Antisense; AAAGAGAATCCCCTCGAGCCAATGT
>probe:Drosophila_2:1624262_at:624:45; Interrogation_Position=1746; Antisense; ATCCCCTCGAGCCAATGTAGTTGAA

Paste this into a BLAST search page for me
ACCAAAATTCCCACCAAGCTTCAATACCAAGCTTCAATCCAACTCGCTGGAACTCGCTGGCCTGCGATTACCAATGCGATTACCAATGGGCCTTAGCATTGCCTTAGCATTAGCCTCGTCTAAAAAACGATGGGTCCAATTGATGCCCCGGATGCCCCGCACACAAAATAGTCAATAGTCAAATTGCATGCACAATACGCGCACAATACGCAAATTATGAGCATTGTTAATAGTACCTCGATTACATTTTACATATTAGTCGTAGGCAAATCCCTTAGGCAAATCCCTGACTTACCCAAAAAAGAGAATCCCCTCGAGCCAATGTATCCCCTCGAGCCAATGTAGTTGAA

Full Affymetrix probeset data:

Annotations for 1624262_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720