Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624263_at:

>probe:Drosophila_2:1624263_at:444:683; Interrogation_Position=1268; Antisense; TATCCACATGGAATTGCCCTACGGC
>probe:Drosophila_2:1624263_at:530:287; Interrogation_Position=1330; Antisense; CGGCACTTCAGGATGACGGCTTGAT
>probe:Drosophila_2:1624263_at:381:141; Interrogation_Position=1345; Antisense; ACGGCTTGATCTTTCTGTGGGTCAC
>probe:Drosophila_2:1624263_at:678:319; Interrogation_Position=1421; Antisense; GCGCGTGGACGAACTCATCTGGGTA
>probe:Drosophila_2:1624263_at:620:491; Interrogation_Position=1443; Antisense; GTAAAGACCAACCAACTGCAGCGAA
>probe:Drosophila_2:1624263_at:65:595; Interrogation_Position=1478; Antisense; TGGGCGCACTGGTCATTGGCTAAAC
>probe:Drosophila_2:1624263_at:496:613; Interrogation_Position=1552; Antisense; TGAACCGCGGACTCGATTGCGATGT
>probe:Drosophila_2:1624263_at:188:481; Interrogation_Position=1627; Antisense; GTATTATCGAGCGTCTAAGCCCGGG
>probe:Drosophila_2:1624263_at:462:659; Interrogation_Position=1642; Antisense; TAAGCCCGGGTACTCGCAAGATCGA
>probe:Drosophila_2:1624263_at:498:215; Interrogation_Position=1659; Antisense; AAGATCGAGCTCTTTGGGCGTCCGC
>probe:Drosophila_2:1624263_at:411:143; Interrogation_Position=1721; Antisense; ACTGGATGGCATTCGACTGGTGGAT
>probe:Drosophila_2:1624263_at:321:545; Interrogation_Position=1742; Antisense; GGATCCGGAGCTAATTACGCAGTTC
>probe:Drosophila_2:1624263_at:615:349; Interrogation_Position=1760; Antisense; GCAGTTCCAGAAGCGTTATCCAGAT
>probe:Drosophila_2:1624263_at:326:441; Interrogation_Position=1782; Antisense; GATGGTAACTGCATGTCGCCAGCTT

Paste this into a BLAST search page for me
TATCCACATGGAATTGCCCTACGGCCGGCACTTCAGGATGACGGCTTGATACGGCTTGATCTTTCTGTGGGTCACGCGCGTGGACGAACTCATCTGGGTAGTAAAGACCAACCAACTGCAGCGAATGGGCGCACTGGTCATTGGCTAAACTGAACCGCGGACTCGATTGCGATGTGTATTATCGAGCGTCTAAGCCCGGGTAAGCCCGGGTACTCGCAAGATCGAAAGATCGAGCTCTTTGGGCGTCCGCACTGGATGGCATTCGACTGGTGGATGGATCCGGAGCTAATTACGCAGTTCGCAGTTCCAGAAGCGTTATCCAGATGATGGTAACTGCATGTCGCCAGCTT

Full Affymetrix probeset data:

Annotations for 1624263_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime