FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624264_at:

>probe:Drosophila_2:1624264_at:16:301; Interrogation_Position=191; Antisense; CGCCGCATCTAATGGATTTCCTACA
>probe:Drosophila_2:1624264_at:199:511; Interrogation_Position=258; Antisense; GTGCAACATATTCAACCGTGGCATG
>probe:Drosophila_2:1624264_at:481:435; Interrogation_Position=282; Antisense; GAGGTGCTTCGATACTTACTCCAAG
>probe:Drosophila_2:1624264_at:472:309; Interrogation_Position=302; Antisense; CCAAGCGTTGCCTGGACGATCGAAA
>probe:Drosophila_2:1624264_at:566:79; Interrogation_Position=353; Antisense; AGGGAGCTCGGCGATTTTTCTACAA
>probe:Drosophila_2:1624264_at:648:699; Interrogation_Position=367; Antisense; TTTTTCTACAAGTTCTGCGGCGACG
>probe:Drosophila_2:1624264_at:64:301; Interrogation_Position=390; Antisense; CGCCGATTTTCAGCGTGACTATCTG
>probe:Drosophila_2:1624264_at:170:405; Interrogation_Position=424; Antisense; GACTGCTTTGCATACATCCAACTGG
>probe:Drosophila_2:1624264_at:188:313; Interrogation_Position=517; Antisense; GCCAGCGAAAAGTTCCTCGAATTCT
>probe:Drosophila_2:1624264_at:17:341; Interrogation_Position=551; Antisense; GCTACGCGTACGAGAACTGCATCTA
>probe:Drosophila_2:1624264_at:633:505; Interrogation_Position=581; Antisense; GTGCCCGCTTCAAGTGCTACAAAAA
>probe:Drosophila_2:1624264_at:435:429; Interrogation_Position=613; Antisense; GAGTTTGCCCGCGAGACGGCCAAAA
>probe:Drosophila_2:1624264_at:439:691; Interrogation_Position=658; Antisense; TTTAGGAACTGTGCCGTCCTCCAGA
>probe:Drosophila_2:1624264_at:175:441; Interrogation_Position=729; Antisense; GATGGCGACGCCGATGATGCTGCTC

Paste this into a BLAST search page for me
CGCCGCATCTAATGGATTTCCTACAGTGCAACATATTCAACCGTGGCATGGAGGTGCTTCGATACTTACTCCAAGCCAAGCGTTGCCTGGACGATCGAAAAGGGAGCTCGGCGATTTTTCTACAATTTTTCTACAAGTTCTGCGGCGACGCGCCGATTTTCAGCGTGACTATCTGGACTGCTTTGCATACATCCAACTGGGCCAGCGAAAAGTTCCTCGAATTCTGCTACGCGTACGAGAACTGCATCTAGTGCCCGCTTCAAGTGCTACAAAAAGAGTTTGCCCGCGAGACGGCCAAAATTTAGGAACTGTGCCGTCCTCCAGAGATGGCGACGCCGATGATGCTGCTC

Full Affymetrix probeset data:

Annotations for 1624264_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720