Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624265_at:

>probe:Drosophila_2:1624265_at:575:527; Interrogation_Position=5191; Antisense; GGGACCGCATCATTTGCGCCAAGAT
>probe:Drosophila_2:1624265_at:723:315; Interrogation_Position=5220; Antisense; GCCTGCGCAAGTTTGAGAACCTCAC
>probe:Drosophila_2:1624265_at:633:349; Interrogation_Position=5245; Antisense; GCAGTCCACATCAAACTCGAACTTT
>probe:Drosophila_2:1624265_at:517:695; Interrogation_Position=5267; Antisense; TTTCCCTTCGAAAGCAACACGCTGA
>probe:Drosophila_2:1624265_at:273:135; Interrogation_Position=5285; Antisense; ACGCTGAAGCGGGTGCCCATGCAGA
>probe:Drosophila_2:1624265_at:108:269; Interrogation_Position=5302; Antisense; CATGCAGACCACCAAAGACTACGAC
>probe:Drosophila_2:1624265_at:253:513; Interrogation_Position=5330; Antisense; GTGAGCCACACACAGAGCTGCATAA
>probe:Drosophila_2:1624265_at:425:183; Interrogation_Position=5360; Antisense; AAAAGTGGCAGCAGTGGAGTCCTCG
>probe:Drosophila_2:1624265_at:568:319; Interrogation_Position=5392; Antisense; GCCGCAGCGTCAGAGAGGATCCGAT
>probe:Drosophila_2:1624265_at:335:55; Interrogation_Position=5486; Antisense; ATGAACAGTACATGCTGCTCTGCCT
>probe:Drosophila_2:1624265_at:671:465; Interrogation_Position=5542; Antisense; GATTGTCAAGGAGCGGTTCATCGAA
>probe:Drosophila_2:1624265_at:411:599; Interrogation_Position=5581; Antisense; TGTCGTGCGCGGATACCATGGCAAA
>probe:Drosophila_2:1624265_at:70:299; Interrogation_Position=5664; Antisense; CGCCCGCCAAGATATCCTTTGATAG
>probe:Drosophila_2:1624265_at:680:457; Interrogation_Position=5684; Antisense; GATAGTTCCGATATAGACCAGGCCA

Paste this into a BLAST search page for me
GGGACCGCATCATTTGCGCCAAGATGCCTGCGCAAGTTTGAGAACCTCACGCAGTCCACATCAAACTCGAACTTTTTTCCCTTCGAAAGCAACACGCTGAACGCTGAAGCGGGTGCCCATGCAGACATGCAGACCACCAAAGACTACGACGTGAGCCACACACAGAGCTGCATAAAAAAGTGGCAGCAGTGGAGTCCTCGGCCGCAGCGTCAGAGAGGATCCGATATGAACAGTACATGCTGCTCTGCCTGATTGTCAAGGAGCGGTTCATCGAATGTCGTGCGCGGATACCATGGCAAACGCCCGCCAAGATATCCTTTGATAGGATAGTTCCGATATAGACCAGGCCA

Full Affymetrix probeset data:

Annotations for 1624265_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime