FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624266_at:

>probe:Drosophila_2:1624266_at:430:251; Interrogation_Position=1014; Antisense; CAAGAGCTTCTCCTCACCAAGATGA
>probe:Drosophila_2:1624266_at:486:193; Interrogation_Position=439; Antisense; AACTCCGTGCTGTTTGCCCGGGATA
>probe:Drosophila_2:1624266_at:319:347; Interrogation_Position=534; Antisense; GCATCGGCGGACTAATCTTAACTTT
>probe:Drosophila_2:1624266_at:506:517; Interrogation_Position=590; Antisense; GTGTGAGGAAGCCATTCTCCCAGGA
>probe:Drosophila_2:1624266_at:58:417; Interrogation_Position=613; Antisense; GAGCCCTTGGTGGAGTTTGTGCCCA
>probe:Drosophila_2:1624266_at:385:469; Interrogation_Position=645; Antisense; GTTGCTCACCGACGAATGCTTCATA
>probe:Drosophila_2:1624266_at:629:315; Interrogation_Position=702; Antisense; GCCGGTGGAGTTTCAATCGAACTTT
>probe:Drosophila_2:1624266_at:127:243; Interrogation_Position=757; Antisense; AATATGCTGGTCCTGTACTTCGATG
>probe:Drosophila_2:1624266_at:417:637; Interrogation_Position=776; Antisense; TCGATGTCTTGTTTCCGTCGGGAAA
>probe:Drosophila_2:1624266_at:319:219; Interrogation_Position=799; Antisense; AAGTCGAACAAATCCGTAAGCCTGA
>probe:Drosophila_2:1624266_at:707:9; Interrogation_Position=836; Antisense; ATTCGCCATGGACGCACTGGGAGCA
>probe:Drosophila_2:1624266_at:349:113; Interrogation_Position=857; Antisense; AGCAGACGGTGCTCCATCTGGATGA
>probe:Drosophila_2:1624266_at:568:585; Interrogation_Position=948; Antisense; TGGACGTGGCATGAACTTTGATCTG
>probe:Drosophila_2:1624266_at:362:693; Interrogation_Position=964; Antisense; TTTGATCTGCACATCAGCTTCCGTG

Paste this into a BLAST search page for me
CAAGAGCTTCTCCTCACCAAGATGAAACTCCGTGCTGTTTGCCCGGGATAGCATCGGCGGACTAATCTTAACTTTGTGTGAGGAAGCCATTCTCCCAGGAGAGCCCTTGGTGGAGTTTGTGCCCAGTTGCTCACCGACGAATGCTTCATAGCCGGTGGAGTTTCAATCGAACTTTAATATGCTGGTCCTGTACTTCGATGTCGATGTCTTGTTTCCGTCGGGAAAAAGTCGAACAAATCCGTAAGCCTGAATTCGCCATGGACGCACTGGGAGCAAGCAGACGGTGCTCCATCTGGATGATGGACGTGGCATGAACTTTGATCTGTTTGATCTGCACATCAGCTTCCGTG

Full Affymetrix probeset data:

Annotations for 1624266_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720