Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624267_at:

>probe:Drosophila_2:1624267_at:12:641; Interrogation_Position=1329; Antisense; TCTACTAGGCGCCACAATGCAAATC
>probe:Drosophila_2:1624267_at:597:165; Interrogation_Position=1349; Antisense; AAATCCCCAAGCTTCAGGCGGCAGT
>probe:Drosophila_2:1624267_at:412:157; Interrogation_Position=1403; Antisense; ACAACAGCCATTCGGCGGACGAGGT
>probe:Drosophila_2:1624267_at:219:323; Interrogation_Position=1446; Antisense; GCGCCAAGCTGTGTGCCTGATTGAC
>probe:Drosophila_2:1624267_at:223:443; Interrogation_Position=1519; Antisense; GATGACCTCTTCATTTGGCACGGTA
>probe:Drosophila_2:1624267_at:651:537; Interrogation_Position=1540; Antisense; GGTAATGACGAATCCAACGCCAAAT
>probe:Drosophila_2:1624267_at:27:199; Interrogation_Position=1555; Antisense; AACGCCAAATTGGTCCTGGGCAGGG
>probe:Drosophila_2:1624267_at:511:121; Interrogation_Position=1582; Antisense; AGCGTTCTGCCTGCCAAAATACGGA
>probe:Drosophila_2:1624267_at:641:183; Interrogation_Position=1597; Antisense; AAAATACGGATATCACTGCCCCAAT
>probe:Drosophila_2:1624267_at:201:119; Interrogation_Position=1656; Antisense; AGCTGCTTCGTTTAAGCTGCGCACC
>probe:Drosophila_2:1624267_at:659:23; Interrogation_Position=1720; Antisense; ATACCGGAGGATGGGCTTTACCAGC
>probe:Drosophila_2:1624267_at:604:143; Interrogation_Position=1800; Antisense; ACTGCGCTGCATGTGAGAGCCGGAT
>probe:Drosophila_2:1624267_at:690:507; Interrogation_Position=1840; Antisense; GTGCGATGTCGCCTAGACTATTTAT
>probe:Drosophila_2:1624267_at:546:403; Interrogation_Position=1855; Antisense; GACTATTTATTGTTGCTAGCCTAAT

Paste this into a BLAST search page for me
TCTACTAGGCGCCACAATGCAAATCAAATCCCCAAGCTTCAGGCGGCAGTACAACAGCCATTCGGCGGACGAGGTGCGCCAAGCTGTGTGCCTGATTGACGATGACCTCTTCATTTGGCACGGTAGGTAATGACGAATCCAACGCCAAATAACGCCAAATTGGTCCTGGGCAGGGAGCGTTCTGCCTGCCAAAATACGGAAAAATACGGATATCACTGCCCCAATAGCTGCTTCGTTTAAGCTGCGCACCATACCGGAGGATGGGCTTTACCAGCACTGCGCTGCATGTGAGAGCCGGATGTGCGATGTCGCCTAGACTATTTATGACTATTTATTGTTGCTAGCCTAAT

Full Affymetrix probeset data:

Annotations for 1624267_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime