Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624269_at:

>probe:Drosophila_2:1624269_at:170:283; Interrogation_Position=1726; Antisense; CTGCCCAGATTTGTGACTGGCGAGG
>probe:Drosophila_2:1624269_at:329:215; Interrogation_Position=1877; Antisense; AAGATACGTCTTATAAGGCCTCACA
>probe:Drosophila_2:1624269_at:263:227; Interrogation_Position=1891; Antisense; AAGGCCTCACAAATGGCTTTTGAAT
>probe:Drosophila_2:1624269_at:334:363; Interrogation_Position=1912; Antisense; GAATTCGTTGAAATATCTGGTCTAT
>probe:Drosophila_2:1624269_at:278:639; Interrogation_Position=1927; Antisense; TCTGGTCTATGGCAACTATTCACGT
>probe:Drosophila_2:1624269_at:368:705; Interrogation_Position=1945; Antisense; TTCACGTTTGAATCAGTTACTTTTA
>probe:Drosophila_2:1624269_at:506:327; Interrogation_Position=2007; Antisense; GCGATCCTATTTTTGGATTCAGGCA
>probe:Drosophila_2:1624269_at:243:289; Interrogation_Position=2043; Antisense; CGGTAAATGTCCAATTCTGCCCATA
>probe:Drosophila_2:1624269_at:583:711; Interrogation_Position=2057; Antisense; TTCTGCCCATACTTCTTGGATCGGA
>probe:Drosophila_2:1624269_at:426:273; Interrogation_Position=2071; Antisense; CTTGGATCGGAGTGCTAATTCTGTT
>probe:Drosophila_2:1624269_at:627:339; Interrogation_Position=2084; Antisense; GCTAATTCTGTTTGCACCGCAGGTA
>probe:Drosophila_2:1624269_at:543:477; Interrogation_Position=2093; Antisense; GTTTGCACCGCAGGTAAAACCATCA
>probe:Drosophila_2:1624269_at:469:537; Interrogation_Position=2105; Antisense; GGTAAAACCATCAAGTTCACTCAGT
>probe:Drosophila_2:1624269_at:505:473; Interrogation_Position=2119; Antisense; GTTCACTCAGTTTTCAGTACCATAA

Paste this into a BLAST search page for me
CTGCCCAGATTTGTGACTGGCGAGGAAGATACGTCTTATAAGGCCTCACAAAGGCCTCACAAATGGCTTTTGAATGAATTCGTTGAAATATCTGGTCTATTCTGGTCTATGGCAACTATTCACGTTTCACGTTTGAATCAGTTACTTTTAGCGATCCTATTTTTGGATTCAGGCACGGTAAATGTCCAATTCTGCCCATATTCTGCCCATACTTCTTGGATCGGACTTGGATCGGAGTGCTAATTCTGTTGCTAATTCTGTTTGCACCGCAGGTAGTTTGCACCGCAGGTAAAACCATCAGGTAAAACCATCAAGTTCACTCAGTGTTCACTCAGTTTTCAGTACCATAA

Full Affymetrix probeset data:

Annotations for 1624269_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime