FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624271_at:

>probe:Drosophila_2:1624271_at:109:553; Interrogation_Position=222; Antisense; GGAGCAGCCGGCAGGTTTCAAAACC
>probe:Drosophila_2:1624271_at:698:529; Interrogation_Position=375; Antisense; GGGATCATCACAAATCGCGGTCTAT
>probe:Drosophila_2:1624271_at:108:167; Interrogation_Position=386; Antisense; AAATCGCGGTCTATTTCGCAGAGGA
>probe:Drosophila_2:1624271_at:89:641; Interrogation_Position=428; Antisense; TCGGAAAGCAATTCCCGATCCGCAA
>probe:Drosophila_2:1624271_at:456:119; Interrogation_Position=463; Antisense; AGCTGCTCCCGTGAAGGCCATCGAT
>probe:Drosophila_2:1624271_at:334:629; Interrogation_Position=483; Antisense; TCGATCTGTTCGACACCAAGGTGCA
>probe:Drosophila_2:1624271_at:596:423; Interrogation_Position=518; Antisense; GAGACTATAGACGAGGACACCTTCA
>probe:Drosophila_2:1624271_at:608:305; Interrogation_Position=537; Antisense; CCTTCAAGCCGGAGTCATTTTTTAG
>probe:Drosophila_2:1624271_at:281:497; Interrogation_Position=550; Antisense; GTCATTTTTTAGCTCCAGGGATTCA
>probe:Drosophila_2:1624271_at:227:53; Interrogation_Position=612; Antisense; ATGAAACGGTCACAGTCGCCAGCAA
>probe:Drosophila_2:1624271_at:434:127; Interrogation_Position=640; Antisense; AGCCACTGCAGTCCGAAACGAAGAT
>probe:Drosophila_2:1624271_at:406:599; Interrogation_Position=664; Antisense; TGTAATATTCCATCCGAACTTCCTG
>probe:Drosophila_2:1624271_at:364:191; Interrogation_Position=680; Antisense; AACTTCCTGGGCGACCCGGATATGA
>probe:Drosophila_2:1624271_at:141:573; Interrogation_Position=717; Antisense; GGCTGCGCAAGCTGTACAATTACCG

Paste this into a BLAST search page for me
GGAGCAGCCGGCAGGTTTCAAAACCGGGATCATCACAAATCGCGGTCTATAAATCGCGGTCTATTTCGCAGAGGATCGGAAAGCAATTCCCGATCCGCAAAGCTGCTCCCGTGAAGGCCATCGATTCGATCTGTTCGACACCAAGGTGCAGAGACTATAGACGAGGACACCTTCACCTTCAAGCCGGAGTCATTTTTTAGGTCATTTTTTAGCTCCAGGGATTCAATGAAACGGTCACAGTCGCCAGCAAAGCCACTGCAGTCCGAAACGAAGATTGTAATATTCCATCCGAACTTCCTGAACTTCCTGGGCGACCCGGATATGAGGCTGCGCAAGCTGTACAATTACCG

Full Affymetrix probeset data:

Annotations for 1624271_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720