Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624272_at:

>probe:Drosophila_2:1624272_at:121:99; Interrogation_Position=440; Antisense; AGATGTGCGTAGTCGATCCCACGGA
>probe:Drosophila_2:1624272_at:303:429; Interrogation_Position=463; Antisense; GAGTTCAACGTCCTGAATCACGGTG
>probe:Drosophila_2:1624272_at:377:651; Interrogation_Position=480; Antisense; TCACGGTGATTCTTGGTCCAATAAC
>probe:Drosophila_2:1624272_at:616:23; Interrogation_Position=548; Antisense; ATATGGTCGACTTTCAGGTCTCGAA
>probe:Drosophila_2:1624272_at:692:79; Interrogation_Position=563; Antisense; AGGTCTCGAAGTACGGCACTGTTGC
>probe:Drosophila_2:1624272_at:398:143; Interrogation_Position=580; Antisense; ACTGTTGCTCAGGACTTGTACTACT
>probe:Drosophila_2:1624272_at:19:669; Interrogation_Position=598; Antisense; TACTACTTCCTGATTTCATCCACAA
>probe:Drosophila_2:1624272_at:461:235; Interrogation_Position=696; Antisense; AATCCTCAAATATTCCAAGCCACTG
>probe:Drosophila_2:1624272_at:604:311; Interrogation_Position=720; Antisense; GCCAAGCCTGCGAGATATCCATAAG
>probe:Drosophila_2:1624272_at:260:561; Interrogation_Position=760; Antisense; GGAACTTTTGCATACTCTGTGGCCA
>probe:Drosophila_2:1624272_at:38:491; Interrogation_Position=790; Antisense; GTAATGGCAGCCGTTCTCGTCGATC
>probe:Drosophila_2:1624272_at:460:47; Interrogation_Position=812; Antisense; ATCCAACGGAGAGCGCCAGTTTCGA
>probe:Drosophila_2:1624272_at:613:387; Interrogation_Position=835; Antisense; GAAAACTTTGTTGGCGATTCCGCCG
>probe:Drosophila_2:1624272_at:620:297; Interrogation_Position=942; Antisense; CCGAGGTGCCCTGGACTTTAATTAG

Paste this into a BLAST search page for me
AGATGTGCGTAGTCGATCCCACGGAGAGTTCAACGTCCTGAATCACGGTGTCACGGTGATTCTTGGTCCAATAACATATGGTCGACTTTCAGGTCTCGAAAGGTCTCGAAGTACGGCACTGTTGCACTGTTGCTCAGGACTTGTACTACTTACTACTTCCTGATTTCATCCACAAAATCCTCAAATATTCCAAGCCACTGGCCAAGCCTGCGAGATATCCATAAGGGAACTTTTGCATACTCTGTGGCCAGTAATGGCAGCCGTTCTCGTCGATCATCCAACGGAGAGCGCCAGTTTCGAGAAAACTTTGTTGGCGATTCCGCCGCCGAGGTGCCCTGGACTTTAATTAG

Full Affymetrix probeset data:

Annotations for 1624272_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime