Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624273_at:

>probe:Drosophila_2:1624273_at:661:443; Interrogation_Position=1516; Antisense; GATGATTTGGCTTTCGATCTGCGGT
>probe:Drosophila_2:1624273_at:484:519; Interrogation_Position=1548; Antisense; GTGGATCCGCACTGAGCAACTTCAC
>probe:Drosophila_2:1624273_at:514:201; Interrogation_Position=1576; Antisense; AACCGTATCCGAATATTGCTCACTG
>probe:Drosophila_2:1624273_at:657:11; Interrogation_Position=1618; Antisense; ATTCGGCTGGCATCTGGTGGGCAAA
>probe:Drosophila_2:1624273_at:216:513; Interrogation_Position=1634; Antisense; GTGGGCAAAGCCCTATTTGTGATCA
>probe:Drosophila_2:1624273_at:178:693; Interrogation_Position=1649; Antisense; TTTGTGATCACATTCGGACCGCTCA
>probe:Drosophila_2:1624273_at:192:299; Interrogation_Position=1668; Antisense; CGCTCATTGGTCTCATTCGGGATGT
>probe:Drosophila_2:1624273_at:204:61; Interrogation_Position=1689; Antisense; ATGTGACCGACAGCTATCCGATTTG
>probe:Drosophila_2:1624273_at:60:693; Interrogation_Position=1710; Antisense; TTTGCATACACACCCAGAGCGTTTG
>probe:Drosophila_2:1624273_at:68:33; Interrogation_Position=1736; Antisense; ATAATGATTTGTGCCACTGCCTGGG
>probe:Drosophila_2:1624273_at:380:725; Interrogation_Position=1776; Antisense; TTGAGTACATTCAGTCGCGACGTCG
>probe:Drosophila_2:1624273_at:167:325; Interrogation_Position=1963; Antisense; GCGAGTACGAGTGCCCAACTATAAA
>probe:Drosophila_2:1624273_at:189:213; Interrogation_Position=2021; Antisense; AAGACTACGTTTGATCCTCGAGTGT
>probe:Drosophila_2:1624273_at:251:433; Interrogation_Position=2040; Antisense; GAGTGTGGAGGCCTAATACCCCAAA

Paste this into a BLAST search page for me
GATGATTTGGCTTTCGATCTGCGGTGTGGATCCGCACTGAGCAACTTCACAACCGTATCCGAATATTGCTCACTGATTCGGCTGGCATCTGGTGGGCAAAGTGGGCAAAGCCCTATTTGTGATCATTTGTGATCACATTCGGACCGCTCACGCTCATTGGTCTCATTCGGGATGTATGTGACCGACAGCTATCCGATTTGTTTGCATACACACCCAGAGCGTTTGATAATGATTTGTGCCACTGCCTGGGTTGAGTACATTCAGTCGCGACGTCGGCGAGTACGAGTGCCCAACTATAAAAAGACTACGTTTGATCCTCGAGTGTGAGTGTGGAGGCCTAATACCCCAAA

Full Affymetrix probeset data:

Annotations for 1624273_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime