FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624274_at:

>probe:Drosophila_2:1624274_at:59:625; Interrogation_Position=440; Antisense; TGCCCAGATTTGTGGTAGGTCTTGT
>probe:Drosophila_2:1624274_at:416:459; Interrogation_Position=446; Antisense; GATTTGTGGTAGGTCTTGTGAGATT
>probe:Drosophila_2:1624274_at:105:485; Interrogation_Position=454; Antisense; GTAGGTCTTGTGAGATTTTTGAATC
>probe:Drosophila_2:1624274_at:242:677; Interrogation_Position=471; Antisense; TTTGAATCAAAGTCCATTGCAACTG
>probe:Drosophila_2:1624274_at:97:35; Interrogation_Position=476; Antisense; ATCAAAGTCCATTGCAACTGGTGCT
>probe:Drosophila_2:1624274_at:368:171; Interrogation_Position=479; Antisense; AAAGTCCATTGCAACTGGTGCTCTT
>probe:Drosophila_2:1624274_at:308:87; Interrogation_Position=481; Antisense; AGTCCATTGCAACTGGTGCTCTTTG
>probe:Drosophila_2:1624274_at:430:5; Interrogation_Position=486; Antisense; ATTGCAACTGGTGCTCTTTGCTTTC
>probe:Drosophila_2:1624274_at:360:615; Interrogation_Position=488; Antisense; TGCAACTGGTGCTCTTTGCTTTCCA
>probe:Drosophila_2:1624274_at:91:197; Interrogation_Position=491; Antisense; AACTGGTGCTCTTTGCTTTCCAGAC
>probe:Drosophila_2:1624274_at:88:593; Interrogation_Position=494; Antisense; TGGTGCTCTTTGCTTTCCAGACTGG
>probe:Drosophila_2:1624274_at:75:621; Interrogation_Position=497; Antisense; TGCTCTTTGCTTTCCAGACTGGCGA
>probe:Drosophila_2:1624274_at:427:635; Interrogation_Position=500; Antisense; TCTTTGCTTTCCAGACTGGCGAGGA
>probe:Drosophila_2:1624274_at:256:721; Interrogation_Position=503; Antisense; TTGCTTTCCAGACTGGCGAGGACAC

Paste this into a BLAST search page for me
TGCCCAGATTTGTGGTAGGTCTTGTGATTTGTGGTAGGTCTTGTGAGATTGTAGGTCTTGTGAGATTTTTGAATCTTTGAATCAAAGTCCATTGCAACTGATCAAAGTCCATTGCAACTGGTGCTAAAGTCCATTGCAACTGGTGCTCTTAGTCCATTGCAACTGGTGCTCTTTGATTGCAACTGGTGCTCTTTGCTTTCTGCAACTGGTGCTCTTTGCTTTCCAAACTGGTGCTCTTTGCTTTCCAGACTGGTGCTCTTTGCTTTCCAGACTGGTGCTCTTTGCTTTCCAGACTGGCGATCTTTGCTTTCCAGACTGGCGAGGATTGCTTTCCAGACTGGCGAGGACAC

Full Affymetrix probeset data:

Annotations for 1624274_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720