FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624275_at:

>probe:Drosophila_2:1624275_at:41:461; Interrogation_Position=3031; Antisense; GATTTGCCGCGTTGATTTTCAGTGC
>probe:Drosophila_2:1624275_at:539:63; Interrogation_Position=3120; Antisense; ATGTGTATGTGTGTCTGCAAGGTGA
>probe:Drosophila_2:1624275_at:376:223; Interrogation_Position=3138; Antisense; AAGGTGAAAGCGTCACTTCCACGCC
>probe:Drosophila_2:1624275_at:412:199; Interrogation_Position=3182; Antisense; AACGAGCTCGTTTATCTTGATTAAA
>probe:Drosophila_2:1624275_at:677:3; Interrogation_Position=3238; Antisense; ATTGAAATTTATGTGGCGCCCGTGC
>probe:Drosophila_2:1624275_at:33:577; Interrogation_Position=3252; Antisense; GGCGCCCGTGCTAATTGACTGCCAA
>probe:Drosophila_2:1624275_at:320:723; Interrogation_Position=3266; Antisense; TTGACTGCCAACTAGACACGCTACC
>probe:Drosophila_2:1624275_at:16:543; Interrogation_Position=3349; Antisense; GGATTCCACGTACCTACTCAAATTT
>probe:Drosophila_2:1624275_at:568:687; Interrogation_Position=3379; Antisense; TATTATTTGGCTTCTACTTGGTTGG
>probe:Drosophila_2:1624275_at:129:365; Interrogation_Position=3403; Antisense; GAATTTGTTAGCGTGTTGCCTTAGC
>probe:Drosophila_2:1624275_at:534:329; Interrogation_Position=3413; Antisense; GCGTGTTGCCTTAGCTGAAGATTTT
>probe:Drosophila_2:1624275_at:102:597; Interrogation_Position=3458; Antisense; TGTGCTCGACAAGCGATGGGCTCAA
>probe:Drosophila_2:1624275_at:407:389; Interrogation_Position=3518; Antisense; GAAAACTCAGTTTTTGTCTACTATA
>probe:Drosophila_2:1624275_at:338:507; Interrogation_Position=3566; Antisense; GTGCGTTTACGTATTCTAAGATGCT

Paste this into a BLAST search page for me
GATTTGCCGCGTTGATTTTCAGTGCATGTGTATGTGTGTCTGCAAGGTGAAAGGTGAAAGCGTCACTTCCACGCCAACGAGCTCGTTTATCTTGATTAAAATTGAAATTTATGTGGCGCCCGTGCGGCGCCCGTGCTAATTGACTGCCAATTGACTGCCAACTAGACACGCTACCGGATTCCACGTACCTACTCAAATTTTATTATTTGGCTTCTACTTGGTTGGGAATTTGTTAGCGTGTTGCCTTAGCGCGTGTTGCCTTAGCTGAAGATTTTTGTGCTCGACAAGCGATGGGCTCAAGAAAACTCAGTTTTTGTCTACTATAGTGCGTTTACGTATTCTAAGATGCT

Full Affymetrix probeset data:

Annotations for 1624275_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720