FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624278_at:

>probe:Drosophila_2:1624278_at:273:627; Interrogation_Position=466; Antisense; TGCCGTCGGCGATGAGCTGAAGTAC
>probe:Drosophila_2:1624278_at:312:227; Interrogation_Position=512; Antisense; AAGGCTGGCGATATCCTCAAGACCT
>probe:Drosophila_2:1624278_at:717:211; Interrogation_Position=530; Antisense; AAGACCTCGCGCTTTATTCCTAGGA
>probe:Drosophila_2:1624278_at:131:551; Interrogation_Position=550; Antisense; TAGGATTCCGGTGCGTCCCAACGAA
>probe:Drosophila_2:1624278_at:38:227; Interrogation_Position=573; Antisense; AAGGCGATGCCTATCCATTGGGCGC
>probe:Drosophila_2:1624278_at:504:357; Interrogation_Position=609; Antisense; GCACACGCATTCACTGTCTGGAGAA
>probe:Drosophila_2:1624278_at:101:579; Interrogation_Position=641; Antisense; GGCCAGATGTGCCACCTGATCCATG
>probe:Drosophila_2:1624278_at:412:129; Interrogation_Position=683; Antisense; ACCATTCTGCGCAAGTTCGACGAAA
>probe:Drosophila_2:1624278_at:2:185; Interrogation_Position=705; Antisense; AAAAGGTGGTGGTGCAGCTGCCCTC
>probe:Drosophila_2:1624278_at:444:161; Interrogation_Position=798; Antisense; ACAAGGAGCATGTGGGCAGTGCCCA
>probe:Drosophila_2:1624278_at:89:99; Interrogation_Position=834; Antisense; AGATGGGCAATCGACCACGTTCCGG
>probe:Drosophila_2:1624278_at:236:257; Interrogation_Position=849; Antisense; CACGTTCCGGTCTGTGGAAGCGCAA
>probe:Drosophila_2:1624278_at:116:215; Interrogation_Position=893; Antisense; AAGATACGCCGATTGCCGCCCATGA
>probe:Drosophila_2:1624278_at:439:33; Interrogation_Position=956; Antisense; ATCAAGTTGACGCTGCCCCTGTGAG

Paste this into a BLAST search page for me
TGCCGTCGGCGATGAGCTGAAGTACAAGGCTGGCGATATCCTCAAGACCTAAGACCTCGCGCTTTATTCCTAGGATAGGATTCCGGTGCGTCCCAACGAAAAGGCGATGCCTATCCATTGGGCGCGCACACGCATTCACTGTCTGGAGAAGGCCAGATGTGCCACCTGATCCATGACCATTCTGCGCAAGTTCGACGAAAAAAAGGTGGTGGTGCAGCTGCCCTCACAAGGAGCATGTGGGCAGTGCCCAAGATGGGCAATCGACCACGTTCCGGCACGTTCCGGTCTGTGGAAGCGCAAAAGATACGCCGATTGCCGCCCATGAATCAAGTTGACGCTGCCCCTGTGAG

Full Affymetrix probeset data:

Annotations for 1624278_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720