FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624280_at:

>probe:Drosophila_2:1624280_at:99:573; Interrogation_Position=1132; Antisense; GGCCAACCAGGAGGGCGGCTTCAAA
>probe:Drosophila_2:1624280_at:50:219; Interrogation_Position=1163; Antisense; AAGTACTTCAGCATCGACAAGGTGT
>probe:Drosophila_2:1624280_at:133:601; Interrogation_Position=1185; Antisense; TGTTCCGCAACGAAACACTGGACGC
>probe:Drosophila_2:1624280_at:444:41; Interrogation_Position=1215; Antisense; ATCTGGCGGAGTTCCATCAGGTGGA
>probe:Drosophila_2:1624280_at:585:725; Interrogation_Position=1257; Antisense; TTGGTCTGACGCTGGGCGATCTCAT
>probe:Drosophila_2:1624280_at:602:3; Interrogation_Position=1280; Antisense; ATTGGCACGCTGTACGAGTTCTTCA
>probe:Drosophila_2:1624280_at:220:429; Interrogation_Position=1295; Antisense; GAGTTCTTCAGAAAGCTGGGCATCA
>probe:Drosophila_2:1624280_at:136:595; Interrogation_Position=1311; Antisense; TGGGCATCACGCAGCTTGAATTCAA
>probe:Drosophila_2:1624280_at:20:349; Interrogation_Position=1365; Antisense; GCATGGAGATCTTCTGCTATCACCC
>probe:Drosophila_2:1624280_at:434:289; Interrogation_Position=1437; Antisense; CGGAGATGCTGCTGCCCATGGGACT
>probe:Drosophila_2:1624280_at:349:553; Interrogation_Position=1501; Antisense; GGAGCGACCCACCATGATCAAGTAC
>probe:Drosophila_2:1624280_at:94:191; Interrogation_Position=1535; Antisense; AACATTCGCGATTTGGTCGGACCCA
>probe:Drosophila_2:1624280_at:184:643; Interrogation_Position=1593; Antisense; TCTGCCGGCTGGATCATGCTTAATA
>probe:Drosophila_2:1624280_at:276:555; Interrogation_Position=1634; Antisense; GGACCTGCGATCAAATTGCATTTTT

Paste this into a BLAST search page for me
GGCCAACCAGGAGGGCGGCTTCAAAAAGTACTTCAGCATCGACAAGGTGTTGTTCCGCAACGAAACACTGGACGCATCTGGCGGAGTTCCATCAGGTGGATTGGTCTGACGCTGGGCGATCTCATATTGGCACGCTGTACGAGTTCTTCAGAGTTCTTCAGAAAGCTGGGCATCATGGGCATCACGCAGCTTGAATTCAAGCATGGAGATCTTCTGCTATCACCCCGGAGATGCTGCTGCCCATGGGACTGGAGCGACCCACCATGATCAAGTACAACATTCGCGATTTGGTCGGACCCATCTGCCGGCTGGATCATGCTTAATAGGACCTGCGATCAAATTGCATTTTT

Full Affymetrix probeset data:

Annotations for 1624280_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720