FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624283_at:

>probe:Drosophila_2:1624283_at:138:149; Interrogation_Position=234; Antisense; ACTTCAGCTACGAGGGCGGTGACCA
>probe:Drosophila_2:1624283_at:245:549; Interrogation_Position=316; Antisense; GGAGGTGTCCGGTATGTACAGCTAC
>probe:Drosophila_2:1624283_at:132:61; Interrogation_Position=329; Antisense; ATGTACAGCTACATCGACGCCGATG
>probe:Drosophila_2:1624283_at:289:135; Interrogation_Position=345; Antisense; ACGCCGATGGCAACACCGTGGAGGT
>probe:Drosophila_2:1624283_at:164:79; Interrogation_Position=366; Antisense; AGGTGCACTACACCGCCGGAAAGAA
>probe:Drosophila_2:1624283_at:357:211; Interrogation_Position=386; Antisense; AAGAACGGATTCGTGCCCATTGGCA
>probe:Drosophila_2:1624283_at:316:273; Interrogation_Position=403; Antisense; CATTGGCACCATCATTCCCAAGGAG
>probe:Drosophila_2:1624283_at:172:427; Interrogation_Position=434; Antisense; GAGTTGGCCAAGTCAGCTGCCCTTC
>probe:Drosophila_2:1624283_at:20:717; Interrogation_Position=456; Antisense; TTCTGCCCAAGGTTTCCGAGGATGA
>probe:Drosophila_2:1624283_at:299:421; Interrogation_Position=479; Antisense; GAGCAGAAGTATCGCAAGGCCCGCT
>probe:Drosophila_2:1624283_at:481:75; Interrogation_Position=564; Antisense; AGGAGCCTGTGGTTGCCAAGGAATC
>probe:Drosophila_2:1624283_at:496:515; Interrogation_Position=593; Antisense; GTGGTGGAGAAATCCGAGCCCCTGC
>probe:Drosophila_2:1624283_at:656:539; Interrogation_Position=712; Antisense; GGTTGAGACCAAGACTGCCTAAGCT
>probe:Drosophila_2:1624283_at:181:627; Interrogation_Position=727; Antisense; TGCCTAAGCTCTCCTAGAACCTAGA

Paste this into a BLAST search page for me
ACTTCAGCTACGAGGGCGGTGACCAGGAGGTGTCCGGTATGTACAGCTACATGTACAGCTACATCGACGCCGATGACGCCGATGGCAACACCGTGGAGGTAGGTGCACTACACCGCCGGAAAGAAAAGAACGGATTCGTGCCCATTGGCACATTGGCACCATCATTCCCAAGGAGGAGTTGGCCAAGTCAGCTGCCCTTCTTCTGCCCAAGGTTTCCGAGGATGAGAGCAGAAGTATCGCAAGGCCCGCTAGGAGCCTGTGGTTGCCAAGGAATCGTGGTGGAGAAATCCGAGCCCCTGCGGTTGAGACCAAGACTGCCTAAGCTTGCCTAAGCTCTCCTAGAACCTAGA

Full Affymetrix probeset data:

Annotations for 1624283_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720