FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624285_at:

>probe:Drosophila_2:1624285_at:1:551; Interrogation_Position=250; Antisense; GGAGTGACCATCTACTTTGGAGCCA
>probe:Drosophila_2:1624285_at:593:271; Interrogation_Position=280; Antisense; CTGAGTCAGGCCCAGTTTACGGTGA
>probe:Drosophila_2:1624285_at:89:429; Interrogation_Position=356; Antisense; GAGTTCCTCGAGTCGGATTCAGCAA
>probe:Drosophila_2:1624285_at:299:533; Interrogation_Position=393; Antisense; GGTGGCCCTTCCATCACTGAGAAAT
>probe:Drosophila_2:1624285_at:164:609; Interrogation_Position=410; Antisense; TGAGAAATCGATCCCAGCGCTACGA
>probe:Drosophila_2:1624285_at:500:529; Interrogation_Position=462; Antisense; GGGAGTGACCACCTTCAGCAATGGA
>probe:Drosophila_2:1624285_at:273:229; Interrogation_Position=481; Antisense; AATGGACTCACCGATGCGCTGCAAT
>probe:Drosophila_2:1624285_at:548:361; Interrogation_Position=501; Antisense; GCAATGCGTCGACCTTCAGATAATG
>probe:Drosophila_2:1624285_at:277:659; Interrogation_Position=531; Antisense; TAACGAGTGTATCGCCTTCTACGGA
>probe:Drosophila_2:1624285_at:701:567; Interrogation_Position=601; Antisense; GGCAGATCCACTTGCTTTGGCGATG
>probe:Drosophila_2:1624285_at:267:605; Interrogation_Position=638; Antisense; TGATCACCAAACAGGATTCCACCGT
>probe:Drosophila_2:1624285_at:47:465; Interrogation_Position=707; Antisense; GATTGCCCGCTGGATTTGCTAGGAT
>probe:Drosophila_2:1624285_at:412:723; Interrogation_Position=722; Antisense; TTGCTAGGATCACCAGCGCACTGGA
>probe:Drosophila_2:1624285_at:465:563; Interrogation_Position=766; Antisense; GGAATCGCCTACTAATGGGTCAAAT

Paste this into a BLAST search page for me
GGAGTGACCATCTACTTTGGAGCCACTGAGTCAGGCCCAGTTTACGGTGAGAGTTCCTCGAGTCGGATTCAGCAAGGTGGCCCTTCCATCACTGAGAAATTGAGAAATCGATCCCAGCGCTACGAGGGAGTGACCACCTTCAGCAATGGAAATGGACTCACCGATGCGCTGCAATGCAATGCGTCGACCTTCAGATAATGTAACGAGTGTATCGCCTTCTACGGAGGCAGATCCACTTGCTTTGGCGATGTGATCACCAAACAGGATTCCACCGTGATTGCCCGCTGGATTTGCTAGGATTTGCTAGGATCACCAGCGCACTGGAGGAATCGCCTACTAATGGGTCAAAT

Full Affymetrix probeset data:

Annotations for 1624285_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720