FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624286_at:

>probe:Drosophila_2:1624286_at:684:7; Interrogation_Position=130; Antisense; ATTGCGTCTGCTTCCTCATATTGTT
>probe:Drosophila_2:1624286_at:78:631; Interrogation_Position=142; Antisense; TCCTCATATTGTTTCTCCGTTTCAA
>probe:Drosophila_2:1624286_at:423:601; Interrogation_Position=186; Antisense; TGATAAGTTTGGTAGGCGTTCCCCG
>probe:Drosophila_2:1624286_at:454:689; Interrogation_Position=253; Antisense; TATTCATACGCATGGCTTCACGAAG
>probe:Drosophila_2:1624286_at:78:375; Interrogation_Position=282; Antisense; GAAGAGTTATTGTCCGTGGCGCCGA
>probe:Drosophila_2:1624286_at:569:521; Interrogation_Position=297; Antisense; GTGGCGCCGATGTTGACAATCACTT
>probe:Drosophila_2:1624286_at:587:611; Interrogation_Position=310; Antisense; TGACAATCACTTGGCGGTCTTCGAC
>probe:Drosophila_2:1624286_at:29:287; Interrogation_Position=323; Antisense; GCGGTCTTCGACTCGATTTTGGAGG
>probe:Drosophila_2:1624286_at:367:381; Interrogation_Position=353; Antisense; GAACCCGAGGGCATATGTGCCAAAA
>probe:Drosophila_2:1624286_at:717:281; Interrogation_Position=380; Antisense; CTCGGTGGTGGAAGGATTCTCAACG
>probe:Drosophila_2:1624286_at:272:659; Interrogation_Position=424; Antisense; TAAGATCTATGGCACCTCCAGGACT
>probe:Drosophila_2:1624286_at:284:149; Interrogation_Position=446; Antisense; ACTTTCGGCGGTGCTGATCACACAA
>probe:Drosophila_2:1624286_at:164:365; Interrogation_Position=478; Antisense; GAATATACTTCAAGCGTGGACCACT
>probe:Drosophila_2:1624286_at:547:329; Interrogation_Position=491; Antisense; GCGTGGACCACTTATAAGGACTTTA

Paste this into a BLAST search page for me
ATTGCGTCTGCTTCCTCATATTGTTTCCTCATATTGTTTCTCCGTTTCAATGATAAGTTTGGTAGGCGTTCCCCGTATTCATACGCATGGCTTCACGAAGGAAGAGTTATTGTCCGTGGCGCCGAGTGGCGCCGATGTTGACAATCACTTTGACAATCACTTGGCGGTCTTCGACGCGGTCTTCGACTCGATTTTGGAGGGAACCCGAGGGCATATGTGCCAAAACTCGGTGGTGGAAGGATTCTCAACGTAAGATCTATGGCACCTCCAGGACTACTTTCGGCGGTGCTGATCACACAAGAATATACTTCAAGCGTGGACCACTGCGTGGACCACTTATAAGGACTTTA

Full Affymetrix probeset data:

Annotations for 1624286_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720