FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624287_at:

>probe:Drosophila_2:1624287_at:427:377; Interrogation_Position=113; Antisense; GAAGCACTCTAGAAGATCTGGCCAA
>probe:Drosophila_2:1624287_at:421:91; Interrogation_Position=137; Antisense; AGTTCCGCCAGGGATCGTCGATTAG
>probe:Drosophila_2:1624287_at:412:509; Interrogation_Position=175; Antisense; GTGCATAAGTTCCTGATGTTCTATC
>probe:Drosophila_2:1624287_at:638:441; Interrogation_Position=212; Antisense; GATGGTCGTACAAGAATCAGCCAAC
>probe:Drosophila_2:1624287_at:382:35; Interrogation_Position=227; Antisense; ATCAGCCAACGGATCTATATCGCAA
>probe:Drosophila_2:1624287_at:533:271; Interrogation_Position=293; Antisense; CATCGGCCGGCAATTCCGAGGATGA
>probe:Drosophila_2:1624287_at:116:499; Interrogation_Position=345; Antisense; GTCCTTTTACGCCATGAAAACATTT
>probe:Drosophila_2:1624287_at:693:99; Interrogation_Position=372; Antisense; AGATGGCTCCACAGTTGTTTACTCA
>probe:Drosophila_2:1624287_at:587:93; Interrogation_Position=38; Antisense; AGTTCGAGAATCTGCGTCGCGTAGC
>probe:Drosophila_2:1624287_at:14:265; Interrogation_Position=383; Antisense; CAGTTGTTTACTCAGCGGTGGTTAA
>probe:Drosophila_2:1624287_at:645:499; Interrogation_Position=437; Antisense; GTCTGAAAACTCTGATGGAAACGCA
>probe:Drosophila_2:1624287_at:185:85; Interrogation_Position=462; Antisense; AGTGGGCTGCGCTTTGAATCGAAAT
>probe:Drosophila_2:1624287_at:481:487; Interrogation_Position=58; Antisense; GTAGCGCTGGCCATATGCGAGAATC
>probe:Drosophila_2:1624287_at:669:41; Interrogation_Position=98; Antisense; ATCGGGAGATATGTCGAAGCACTCT

Paste this into a BLAST search page for me
GAAGCACTCTAGAAGATCTGGCCAAAGTTCCGCCAGGGATCGTCGATTAGGTGCATAAGTTCCTGATGTTCTATCGATGGTCGTACAAGAATCAGCCAACATCAGCCAACGGATCTATATCGCAACATCGGCCGGCAATTCCGAGGATGAGTCCTTTTACGCCATGAAAACATTTAGATGGCTCCACAGTTGTTTACTCAAGTTCGAGAATCTGCGTCGCGTAGCCAGTTGTTTACTCAGCGGTGGTTAAGTCTGAAAACTCTGATGGAAACGCAAGTGGGCTGCGCTTTGAATCGAAATGTAGCGCTGGCCATATGCGAGAATCATCGGGAGATATGTCGAAGCACTCT

Full Affymetrix probeset data:

Annotations for 1624287_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720