FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624288_at:

>probe:Drosophila_2:1624288_at:224:327; Interrogation_Position=1007; Antisense; GCGATCGCAGATTCTACACCAAGGA
>probe:Drosophila_2:1624288_at:437:189; Interrogation_Position=1033; Antisense; AACATGGTGGATCATCTGCTGCGCA
>probe:Drosophila_2:1624288_at:401:233; Interrogation_Position=1094; Antisense; AATGCGGACGCATTTTCCAGAACAG
>probe:Drosophila_2:1624288_at:28:417; Interrogation_Position=1123; Antisense; GAGCTCAACGCTCACGGGAGGAAAC
>probe:Drosophila_2:1624288_at:395:589; Interrogation_Position=656; Antisense; TGGAGGCCCATATGCAGCAGCATGA
>probe:Drosophila_2:1624288_at:603:531; Interrogation_Position=681; Antisense; GGGTCTGAGACCGTATACCTGCGTC
>probe:Drosophila_2:1624288_at:556:27; Interrogation_Position=695; Antisense; ATACCTGCGTCCATTGTGCCAAGAG
>probe:Drosophila_2:1624288_at:265:355; Interrogation_Position=747; Antisense; GCACCTGCGGCAGATGCATAACAAT
>probe:Drosophila_2:1624288_at:441:31; Interrogation_Position=764; Antisense; ATAACAATGCCGACGCTGCGCGGAT
>probe:Drosophila_2:1624288_at:645:49; Interrogation_Position=794; Antisense; ATGCCTGTCCGAGCTGCAACAAGGT
>probe:Drosophila_2:1624288_at:62:515; Interrogation_Position=817; Antisense; GTGTACACAGCGAACCGAAGTCTCA
>probe:Drosophila_2:1624288_at:33:475; Interrogation_Position=870; Antisense; GTATCACGAGTCAGAGTCCCCGGAT
>probe:Drosophila_2:1624288_at:533:619; Interrogation_Position=925; Antisense; TGCTTTGCGCGAAAGGCACATCTAA
>probe:Drosophila_2:1624288_at:7:97; Interrogation_Position=988; Antisense; AGATACTGCTGCGAATGCTGCGATC

Paste this into a BLAST search page for me
GCGATCGCAGATTCTACACCAAGGAAACATGGTGGATCATCTGCTGCGCAAATGCGGACGCATTTTCCAGAACAGGAGCTCAACGCTCACGGGAGGAAACTGGAGGCCCATATGCAGCAGCATGAGGGTCTGAGACCGTATACCTGCGTCATACCTGCGTCCATTGTGCCAAGAGGCACCTGCGGCAGATGCATAACAATATAACAATGCCGACGCTGCGCGGATATGCCTGTCCGAGCTGCAACAAGGTGTGTACACAGCGAACCGAAGTCTCAGTATCACGAGTCAGAGTCCCCGGATTGCTTTGCGCGAAAGGCACATCTAAAGATACTGCTGCGAATGCTGCGATC

Full Affymetrix probeset data:

Annotations for 1624288_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720