Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624289_at:

>probe:Drosophila_2:1624289_at:331:489; Interrogation_Position=1016; Antisense; GTACTGCTACTACCGCATGCTGGAG
>probe:Drosophila_2:1624289_at:277:621; Interrogation_Position=593; Antisense; TGCTGTTAACTTTTGGCTGGGCGAC
>probe:Drosophila_2:1624289_at:594:139; Interrogation_Position=658; Antisense; ACGTGTACTGCGTGATATCCGGTCA
>probe:Drosophila_2:1624289_at:584:669; Interrogation_Position=673; Antisense; TATCCGGTCACAAGGACTTCGTTCT
>probe:Drosophila_2:1624289_at:100:117; Interrogation_Position=712; Antisense; AGCTTAGCTGCGTACCGCGAGGAAT
>probe:Drosophila_2:1624289_at:730:325; Interrogation_Position=728; Antisense; GCGAGGAATTTACCCTACAGGCGTT
>probe:Drosophila_2:1624289_at:311:575; Interrogation_Position=747; Antisense; GGCGTTTACAAGACCTCAGATAGTG
>probe:Drosophila_2:1624289_at:523:369; Interrogation_Position=825; Antisense; GAATGGGTCAGCGTTGATCCCTTGT
>probe:Drosophila_2:1624289_at:291:409; Interrogation_Position=855; Antisense; GACCTGGCCAAATATCCGGAGTACG
>probe:Drosophila_2:1624289_at:692:521; Interrogation_Position=883; Antisense; GGGCCAAGCCTCTGAAAGTACGTGT
>probe:Drosophila_2:1624289_at:234:515; Interrogation_Position=904; Antisense; GTGTTCACGCGGGAGACATCCTATA
>probe:Drosophila_2:1624289_at:362:175; Interrogation_Position=961; Antisense; AAAGCCACAAGTGCATCGCCGTGAA
>probe:Drosophila_2:1624289_at:320:509; Interrogation_Position=981; Antisense; GTGAACTTCTGGTACGATCTGGACT
>probe:Drosophila_2:1624289_at:573:451; Interrogation_Position=996; Antisense; GATCTGGACTACGATAGCCGGTACT

Paste this into a BLAST search page for me
GTACTGCTACTACCGCATGCTGGAGTGCTGTTAACTTTTGGCTGGGCGACACGTGTACTGCGTGATATCCGGTCATATCCGGTCACAAGGACTTCGTTCTAGCTTAGCTGCGTACCGCGAGGAATGCGAGGAATTTACCCTACAGGCGTTGGCGTTTACAAGACCTCAGATAGTGGAATGGGTCAGCGTTGATCCCTTGTGACCTGGCCAAATATCCGGAGTACGGGGCCAAGCCTCTGAAAGTACGTGTGTGTTCACGCGGGAGACATCCTATAAAAGCCACAAGTGCATCGCCGTGAAGTGAACTTCTGGTACGATCTGGACTGATCTGGACTACGATAGCCGGTACT

Full Affymetrix probeset data:

Annotations for 1624289_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime