FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624290_at:

>probe:Drosophila_2:1624290_at:224:709; Interrogation_Position=3356; Antisense; TTACTATGAGACTGTGGCCGGAGGA
>probe:Drosophila_2:1624290_at:9:551; Interrogation_Position=3414; Antisense; GGAGTGCATACCCACATGACGAACA
>probe:Drosophila_2:1624290_at:180:187; Interrogation_Position=3435; Antisense; AACACTCGCATCACTGATCCGGAGA
>probe:Drosophila_2:1624290_at:589:631; Interrogation_Position=3452; Antisense; TCCGGAGATCCTTGAACTGCGCTAT
>probe:Drosophila_2:1624290_at:442:323; Interrogation_Position=3470; Antisense; GCGCTATCCCATGATCCTGAAGAGA
>probe:Drosophila_2:1624290_at:314:615; Interrogation_Position=3487; Antisense; TGAAGAGATTCTGCCTTCGCACCGA
>probe:Drosophila_2:1624290_at:17:99; Interrogation_Position=3604; Antisense; AGAGACGAACTCTGCAGCCCTACGG
>probe:Drosophila_2:1624290_at:471:113; Interrogation_Position=3619; Antisense; AGCCCTACGGTCTCGCAGGTGGAGA
>probe:Drosophila_2:1624290_at:326:637; Interrogation_Position=3686; Antisense; TCGAGTGATCGCTCTGGCAGGCAAA
>probe:Drosophila_2:1624290_at:636:217; Interrogation_Position=3795; Antisense; AAGTCCGGTGAATCCTTGAATCAGG
>probe:Drosophila_2:1624290_at:228:23; Interrogation_Position=3833; Antisense; ATACGTGGAACGAGGAACTGTCTTT
>probe:Drosophila_2:1624290_at:215:497; Interrogation_Position=3852; Antisense; GTCTTTAATTATCTTCAGTGCCAGG
>probe:Drosophila_2:1624290_at:320:267; Interrogation_Position=3867; Antisense; CAGTGCCAGGAGTCTGCCTAAGCAA
>probe:Drosophila_2:1624290_at:613:459; Interrogation_Position=3898; Antisense; GATTTCGCTTTTATATGTGCCATAT

Paste this into a BLAST search page for me
TTACTATGAGACTGTGGCCGGAGGAGGAGTGCATACCCACATGACGAACAAACACTCGCATCACTGATCCGGAGATCCGGAGATCCTTGAACTGCGCTATGCGCTATCCCATGATCCTGAAGAGATGAAGAGATTCTGCCTTCGCACCGAAGAGACGAACTCTGCAGCCCTACGGAGCCCTACGGTCTCGCAGGTGGAGATCGAGTGATCGCTCTGGCAGGCAAAAAGTCCGGTGAATCCTTGAATCAGGATACGTGGAACGAGGAACTGTCTTTGTCTTTAATTATCTTCAGTGCCAGGCAGTGCCAGGAGTCTGCCTAAGCAAGATTTCGCTTTTATATGTGCCATAT

Full Affymetrix probeset data:

Annotations for 1624290_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720