Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624291_at:

>probe:Drosophila_2:1624291_at:496:377; Interrogation_Position=338; Antisense; GAAGCAGCCGTCGTTGTGAACTCCA
>probe:Drosophila_2:1624291_at:515:173; Interrogation_Position=379; Antisense; AAAGCCATCGCCAACGGAACTGAAC
>probe:Drosophila_2:1624291_at:195:559; Interrogation_Position=394; Antisense; GGAACTGAACGGCATTGACTTGAAT
>probe:Drosophila_2:1624291_at:229:365; Interrogation_Position=415; Antisense; GAATGAGGCCTACAAGTTTCTGGAA
>probe:Drosophila_2:1624291_at:197:183; Interrogation_Position=438; Antisense; AAAACGCTTTGATGGGCCAGCCGCA
>probe:Drosophila_2:1624291_at:614:225; Interrogation_Position=524; Antisense; AAGGCAAACACCGACGAATCCGACG
>probe:Drosophila_2:1624291_at:663:367; Interrogation_Position=539; Antisense; GAATCCGACGATGTGGCACGCAGCA
>probe:Drosophila_2:1624291_at:538:521; Interrogation_Position=566; Antisense; GGGCAGCGTTTATTTGACCACCAGT
>probe:Drosophila_2:1624291_at:629:479; Interrogation_Position=624; Antisense; GTTTGGATCCACTATTCCTGGACGA
>probe:Drosophila_2:1624291_at:595:101; Interrogation_Position=697; Antisense; AGAGCATTTATTCATTTCCACACAT
>probe:Drosophila_2:1624291_at:163:491; Interrogation_Position=758; Antisense; GTACATTGTCACACGCATTTGCACC
>probe:Drosophila_2:1624291_at:693:693; Interrogation_Position=775; Antisense; TTTGCACCGCTCCATTATCATCAAT
>probe:Drosophila_2:1624291_at:586:161; Interrogation_Position=801; Antisense; AAATCATCGGATCCCACGTTTATAC
>probe:Drosophila_2:1624291_at:684:623; Interrogation_Position=849; Antisense; TGCCCCAACCTTTGTACGTATTAAT

Paste this into a BLAST search page for me
GAAGCAGCCGTCGTTGTGAACTCCAAAAGCCATCGCCAACGGAACTGAACGGAACTGAACGGCATTGACTTGAATGAATGAGGCCTACAAGTTTCTGGAAAAAACGCTTTGATGGGCCAGCCGCAAAGGCAAACACCGACGAATCCGACGGAATCCGACGATGTGGCACGCAGCAGGGCAGCGTTTATTTGACCACCAGTGTTTGGATCCACTATTCCTGGACGAAGAGCATTTATTCATTTCCACACATGTACATTGTCACACGCATTTGCACCTTTGCACCGCTCCATTATCATCAATAAATCATCGGATCCCACGTTTATACTGCCCCAACCTTTGTACGTATTAAT

Full Affymetrix probeset data:

Annotations for 1624291_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime