Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624292_a_at:

>probe:Drosophila_2:1624292_a_at:212:207; Interrogation_Position=112; Antisense; AAGCGTTCAGTCTAGTTCACAATCA
>probe:Drosophila_2:1624292_a_at:209:263; Interrogation_Position=14; Antisense; CAGTCTAGAGAATACGTTTCCACAA
>probe:Drosophila_2:1624292_a_at:89:463; Interrogation_Position=163; Antisense; GTTGAGAACCCTATACGACTACAGT
>probe:Drosophila_2:1624292_a_at:111:25; Interrogation_Position=195; Antisense; ATAGTGTGAACGATGCGACTGGGCA
>probe:Drosophila_2:1624292_a_at:4:625; Interrogation_Position=208; Antisense; TGCGACTGGGCATTTGATACAAACT
>probe:Drosophila_2:1624292_a_at:369:193; Interrogation_Position=248; Antisense; AACTCGGATGTCATGAGTCCTGATG
>probe:Drosophila_2:1624292_a_at:7:517; Interrogation_Position=282; Antisense; GTGTGCGCCAGCAACTGAACATGGC
>probe:Drosophila_2:1624292_a_at:705:477; Interrogation_Position=29; Antisense; GTTTCCACAATGAACTACTTCGCGG
>probe:Drosophila_2:1624292_a_at:458:169; Interrogation_Position=299; Antisense; AACATGGCATAATTTTGGATTCACC
>probe:Drosophila_2:1624292_a_at:184:7; Interrogation_Position=347; Antisense; ATTGCATATGCTTTTTAACCGCAGT
>probe:Drosophila_2:1624292_a_at:411:659; Interrogation_Position=362; Antisense; TAACCGCAGTTACTTCAAGCAAAAT
>probe:Drosophila_2:1624292_a_at:6:669; Interrogation_Position=44; Antisense; TACTTCGCGGTGATCTGCATTTTCT
>probe:Drosophila_2:1624292_a_at:239:695; Interrogation_Position=64; Antisense; TTTCTCCTGCATTTGCCTTTGGCAA
>probe:Drosophila_2:1624292_a_at:130:691; Interrogation_Position=81; Antisense; TTTGGCAATTTAGCGATGCTGCCCC

Paste this into a BLAST search page for me
AAGCGTTCAGTCTAGTTCACAATCACAGTCTAGAGAATACGTTTCCACAAGTTGAGAACCCTATACGACTACAGTATAGTGTGAACGATGCGACTGGGCATGCGACTGGGCATTTGATACAAACTAACTCGGATGTCATGAGTCCTGATGGTGTGCGCCAGCAACTGAACATGGCGTTTCCACAATGAACTACTTCGCGGAACATGGCATAATTTTGGATTCACCATTGCATATGCTTTTTAACCGCAGTTAACCGCAGTTACTTCAAGCAAAATTACTTCGCGGTGATCTGCATTTTCTTTTCTCCTGCATTTGCCTTTGGCAATTTGGCAATTTAGCGATGCTGCCCC

Full Affymetrix probeset data:

Annotations for 1624292_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime