FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624295_at:

>probe:Drosophila_2:1624295_at:444:629; Interrogation_Position=262; Antisense; TCCACGGAGCCGAAGATCAGCCAAG
>probe:Drosophila_2:1624295_at:410:97; Interrogation_Position=275; Antisense; AGATCAGCCAAGGATTTCGCCTCAA
>probe:Drosophila_2:1624295_at:162:651; Interrogation_Position=296; Antisense; TCAACGTTGTGGTGTCACGGGCCAA
>probe:Drosophila_2:1624295_at:140:595; Interrogation_Position=326; Antisense; TGGGCAACGCGGAGCTCTTCATCAA
>probe:Drosophila_2:1624295_at:11:315; Interrogation_Position=402; Antisense; GCCATCGTTCATCTACTGGTACAAG
>probe:Drosophila_2:1624295_at:222:531; Interrogation_Position=434; Antisense; GGGTCATGAATTACTCGCAGCGCGG
>probe:Drosophila_2:1624295_at:42:533; Interrogation_Position=457; Antisense; GGTGGCATCAACGTCATCACGGAGC
>probe:Drosophila_2:1624295_at:474:111; Interrogation_Position=496; Antisense; AGCAAGCTGCTCATAGCCAAGGCCA
>probe:Drosophila_2:1624295_at:639:329; Interrogation_Position=526; Antisense; GCGGATTCGGGCAACTACACGTGCT
>probe:Drosophila_2:1624295_at:147:265; Interrogation_Position=563; Antisense; CAGATTCTGCCTCCGTGGTGGTGCA
>probe:Drosophila_2:1624295_at:315:273; Interrogation_Position=682; Antisense; CTTGCCACCTGGATGTCGATGACGG
>probe:Drosophila_2:1624295_at:48:561; Interrogation_Position=722; Antisense; GGAACTCTAACCTCAACATCAACTG
>probe:Drosophila_2:1624295_at:660:323; Interrogation_Position=765; Antisense; GCGCTGGCACTGGAACCCTAAATGG
>probe:Drosophila_2:1624295_at:682:225; Interrogation_Position=785; Antisense; AATGGAATTGGAGCAACCTGGCCGC

Paste this into a BLAST search page for me
TCCACGGAGCCGAAGATCAGCCAAGAGATCAGCCAAGGATTTCGCCTCAATCAACGTTGTGGTGTCACGGGCCAATGGGCAACGCGGAGCTCTTCATCAAGCCATCGTTCATCTACTGGTACAAGGGGTCATGAATTACTCGCAGCGCGGGGTGGCATCAACGTCATCACGGAGCAGCAAGCTGCTCATAGCCAAGGCCAGCGGATTCGGGCAACTACACGTGCTCAGATTCTGCCTCCGTGGTGGTGCACTTGCCACCTGGATGTCGATGACGGGGAACTCTAACCTCAACATCAACTGGCGCTGGCACTGGAACCCTAAATGGAATGGAATTGGAGCAACCTGGCCGC

Full Affymetrix probeset data:

Annotations for 1624295_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720