FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624296_at:

>probe:Drosophila_2:1624296_at:529:519; Interrogation_Position=1009; Antisense; GTGGACTTCAGAACCGGAGACCGAC
>probe:Drosophila_2:1624296_at:115:475; Interrogation_Position=1058; Antisense; GTTACTCTGATTTCGACCTTTTTGA
>probe:Drosophila_2:1624296_at:88:585; Interrogation_Position=1084; Antisense; TGGCATTTCCTACTACATCAAGCGT
>probe:Drosophila_2:1624296_at:632:83; Interrogation_Position=1113; Antisense; AGTGGTCAACGCTCAAGTCTCGCAA
>probe:Drosophila_2:1624296_at:484:215; Interrogation_Position=1136; Antisense; AAGATCTTCTTCATTCCCGAACTGG
>probe:Drosophila_2:1624296_at:522:681; Interrogation_Position=758; Antisense; TATCCGCCGGATCTCAGCTATATTG
>probe:Drosophila_2:1624296_at:539:117; Interrogation_Position=773; Antisense; AGCTATATTGTGTCGGCTCGCAAGG
>probe:Drosophila_2:1624296_at:64:437; Interrogation_Position=803; Antisense; GAGGATTACGTGTTCTCCCTGCTCA
>probe:Drosophila_2:1624296_at:484:455; Interrogation_Position=831; Antisense; GATACTGTGATCCTCCGGCTGGTTT
>probe:Drosophila_2:1624296_at:660:721; Interrogation_Position=855; Antisense; TTGCCCTTCGTGATGGACTGTACTT
>probe:Drosophila_2:1624296_at:410:435; Interrogation_Position=932; Antisense; GAGGTGGTCTCCTTTGAAGATCCAA
>probe:Drosophila_2:1624296_at:253:215; Interrogation_Position=948; Antisense; AAGATCCAAATGTGCCTGCTTCGGC
>probe:Drosophila_2:1624296_at:382:247; Interrogation_Position=979; Antisense; AATTGCCAAGGATGTGTGCGTCTTC
>probe:Drosophila_2:1624296_at:460:507; Interrogation_Position=994; Antisense; GTGCGTCTTCCTCAAGTGGACTTCA

Paste this into a BLAST search page for me
GTGGACTTCAGAACCGGAGACCGACGTTACTCTGATTTCGACCTTTTTGATGGCATTTCCTACTACATCAAGCGTAGTGGTCAACGCTCAAGTCTCGCAAAAGATCTTCTTCATTCCCGAACTGGTATCCGCCGGATCTCAGCTATATTGAGCTATATTGTGTCGGCTCGCAAGGGAGGATTACGTGTTCTCCCTGCTCAGATACTGTGATCCTCCGGCTGGTTTTTGCCCTTCGTGATGGACTGTACTTGAGGTGGTCTCCTTTGAAGATCCAAAAGATCCAAATGTGCCTGCTTCGGCAATTGCCAAGGATGTGTGCGTCTTCGTGCGTCTTCCTCAAGTGGACTTCA

Full Affymetrix probeset data:

Annotations for 1624296_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720