FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624297_at:

>probe:Drosophila_2:1624297_at:187:255; Interrogation_Position=2537; Antisense; CACCCTATGAACTCCCCTGTTAAGA
>probe:Drosophila_2:1624297_at:627:99; Interrogation_Position=2602; Antisense; AGAGCCAAGGCCCAGTAAAATTGAT
>probe:Drosophila_2:1624297_at:256:381; Interrogation_Position=2719; Antisense; GAACCCCACGAAAAACCAGTGCTAG
>probe:Drosophila_2:1624297_at:420:203; Interrogation_Position=2732; Antisense; AACCAGTGCTAGGATAGGACCCAAA
>probe:Drosophila_2:1624297_at:709:185; Interrogation_Position=2773; Antisense; AACAGAGAGCGTTGCAAGTTTGCCA
>probe:Drosophila_2:1624297_at:233:63; Interrogation_Position=2803; Antisense; ATGGGATACCAATACGATACCGATA
>probe:Drosophila_2:1624297_at:542:379; Interrogation_Position=2875; Antisense; GAACCGTAGTGCTAGTAAGACTCGA
>probe:Drosophila_2:1624297_at:41:603; Interrogation_Position=2913; Antisense; TGTTAGTGCACATACGACCCCAAAA
>probe:Drosophila_2:1624297_at:469:655; Interrogation_Position=2948; Antisense; TAAGTTACCGCCTCCTTGTACGCGT
>probe:Drosophila_2:1624297_at:80:729; Interrogation_Position=2963; Antisense; TTGTACGCGTAGTGCAGTCTCGAGT
>probe:Drosophila_2:1624297_at:389:509; Interrogation_Position=2974; Antisense; GTGCAGTCTCGAGTTGTAAGTTTTT
>probe:Drosophila_2:1624297_at:499:113; Interrogation_Position=3013; Antisense; AGCAGTTTGCATTAGTTCTTAAGTT
>probe:Drosophila_2:1624297_at:369:475; Interrogation_Position=3035; Antisense; GTTACTCTTATGGTTTTCTATGGCA
>probe:Drosophila_2:1624297_at:342:291; Interrogation_Position=3076; Antisense; CGATTTCAATAAACGTCCGTGCATA

Paste this into a BLAST search page for me
CACCCTATGAACTCCCCTGTTAAGAAGAGCCAAGGCCCAGTAAAATTGATGAACCCCACGAAAAACCAGTGCTAGAACCAGTGCTAGGATAGGACCCAAAAACAGAGAGCGTTGCAAGTTTGCCAATGGGATACCAATACGATACCGATAGAACCGTAGTGCTAGTAAGACTCGATGTTAGTGCACATACGACCCCAAAATAAGTTACCGCCTCCTTGTACGCGTTTGTACGCGTAGTGCAGTCTCGAGTGTGCAGTCTCGAGTTGTAAGTTTTTAGCAGTTTGCATTAGTTCTTAAGTTGTTACTCTTATGGTTTTCTATGGCACGATTTCAATAAACGTCCGTGCATA

Full Affymetrix probeset data:

Annotations for 1624297_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720