FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624298_at:

>probe:Drosophila_2:1624298_at:635:257; Interrogation_Position=425; Antisense; CACAAGCGGCTCTGGTGGGCAAGCA
>probe:Drosophila_2:1624298_at:273:359; Interrogation_Position=443; Antisense; GCAAGCAGGTTGTTCTCCAGGAGTT
>probe:Drosophila_2:1624298_at:523:171; Interrogation_Position=491; Antisense; AAAGATCTCTGTCCCGTGAGCTAGA
>probe:Drosophila_2:1624298_at:120:39; Interrogation_Position=535; Antisense; ATCTCCGCGAGATTGGCACAGCAAA
>probe:Drosophila_2:1624298_at:347:155; Interrogation_Position=552; Antisense; ACAGCAAACGGCACAAGCGGCGCAT
>probe:Drosophila_2:1624298_at:397:121; Interrogation_Position=567; Antisense; AGCGGCGCATCATCACATATCCGTG
>probe:Drosophila_2:1624298_at:492:23; Interrogation_Position=583; Antisense; ATATCCGTGCTCACAGCTGCGGTAA
>probe:Drosophila_2:1624298_at:231:165; Interrogation_Position=616; Antisense; AAATCCGTGGCCGAACAGGCTGAGC
>probe:Drosophila_2:1624298_at:23:71; Interrogation_Position=632; Antisense; AGGCTGAGCAAACCTCCACGGAGGT
>probe:Drosophila_2:1624298_at:301:535; Interrogation_Position=654; Antisense; GGTGAACAATCAACTGGCCTCCCAA
>probe:Drosophila_2:1624298_at:410:115; Interrogation_Position=725; Antisense; AGCAGTTGCACCAGGCGCGCGTAGA
>probe:Drosophila_2:1624298_at:174:81; Interrogation_Position=806; Antisense; AGGTGAATGCATCCAAGGCGGCCCA
>probe:Drosophila_2:1624298_at:391:57; Interrogation_Position=851; Antisense; ATGAGAGCACGAATCCATCAGCCCA
>probe:Drosophila_2:1624298_at:512:549; Interrogation_Position=909; Antisense; GGAGTCCTACGATGAGCACCTAGAC

Paste this into a BLAST search page for me
CACAAGCGGCTCTGGTGGGCAAGCAGCAAGCAGGTTGTTCTCCAGGAGTTAAAGATCTCTGTCCCGTGAGCTAGAATCTCCGCGAGATTGGCACAGCAAAACAGCAAACGGCACAAGCGGCGCATAGCGGCGCATCATCACATATCCGTGATATCCGTGCTCACAGCTGCGGTAAAAATCCGTGGCCGAACAGGCTGAGCAGGCTGAGCAAACCTCCACGGAGGTGGTGAACAATCAACTGGCCTCCCAAAGCAGTTGCACCAGGCGCGCGTAGAAGGTGAATGCATCCAAGGCGGCCCAATGAGAGCACGAATCCATCAGCCCAGGAGTCCTACGATGAGCACCTAGAC

Full Affymetrix probeset data:

Annotations for 1624298_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720