Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624302_at:

>probe:Drosophila_2:1624302_at:346:399; Interrogation_Position=1006; Antisense; GACAGACGCGATAGCAGTCACGAGA
>probe:Drosophila_2:1624302_at:240:89; Interrogation_Position=1021; Antisense; AGTCACGAGACAAGCAGTCCCCAAG
>probe:Drosophila_2:1624302_at:21:71; Interrogation_Position=1047; Antisense; AGGCCCAAGCAAACGCGGAGGTTCA
>probe:Drosophila_2:1624302_at:245:661; Interrogation_Position=1100; Antisense; TAAATGCATATCACTCGGAGTTCCC
>probe:Drosophila_2:1624302_at:649:503; Interrogation_Position=1148; Antisense; GTCCAGGCCAAAGAAACCGCTTCAA
>probe:Drosophila_2:1624302_at:579:411; Interrogation_Position=1181; Antisense; GACCCGGGCCAAATATGGGCGGCAA
>probe:Drosophila_2:1624302_at:96:199; Interrogation_Position=1235; Antisense; AACGATGTTTGCCAGTCCACGTGTA
>probe:Drosophila_2:1624302_at:660:1; Interrogation_Position=1248; Antisense; AGTCCACGTGTACTCCACTTAATAA
>probe:Drosophila_2:1624302_at:699:691; Interrogation_Position=1287; Antisense; TTTGTTTTTCATTGTTCCGCGCGCA
>probe:Drosophila_2:1624302_at:496:719; Interrogation_Position=1301; Antisense; TTCCGCGCGCAGAATCTTTTAGTTA
>probe:Drosophila_2:1624302_at:48:699; Interrogation_Position=1318; Antisense; TTTAGTTAAGCCAACGACGACGACT
>probe:Drosophila_2:1624302_at:336:17; Interrogation_Position=1347; Antisense; ATTTGTCCTATAGCCGTGTACTTTT
>probe:Drosophila_2:1624302_at:268:383; Interrogation_Position=924; Antisense; GAACTCTGGCAATCGTGGGACTAAT
>probe:Drosophila_2:1624302_at:89:299; Interrogation_Position=961; Antisense; CCGGGAGGACGTGGATTTTTCAATG

Paste this into a BLAST search page for me
GACAGACGCGATAGCAGTCACGAGAAGTCACGAGACAAGCAGTCCCCAAGAGGCCCAAGCAAACGCGGAGGTTCATAAATGCATATCACTCGGAGTTCCCGTCCAGGCCAAAGAAACCGCTTCAAGACCCGGGCCAAATATGGGCGGCAAAACGATGTTTGCCAGTCCACGTGTAAGTCCACGTGTACTCCACTTAATAATTTGTTTTTCATTGTTCCGCGCGCATTCCGCGCGCAGAATCTTTTAGTTATTTAGTTAAGCCAACGACGACGACTATTTGTCCTATAGCCGTGTACTTTTGAACTCTGGCAATCGTGGGACTAATCCGGGAGGACGTGGATTTTTCAATG

Full Affymetrix probeset data:

Annotations for 1624302_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime