FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624307_at:

>probe:Drosophila_2:1624307_at:234:437; Interrogation_Position=1102; Antisense; GAGGATGAGATTTTCTTCGCCGTCT
>probe:Drosophila_2:1624307_at:467:633; Interrogation_Position=1118; Antisense; TCGCCGTCTTTCACTGGTTGAATTA
>probe:Drosophila_2:1624307_at:584:281; Interrogation_Position=1131; Antisense; CTGGTTGAATTACTCCTGGACGGAA
>probe:Drosophila_2:1624307_at:354:541; Interrogation_Position=1214; Antisense; GGTTGCGTCGATCCATTTGTAATAT
>probe:Drosophila_2:1624307_at:273:157; Interrogation_Position=1306; Antisense; ACACTTTTGTGTCAGGCGATCATTG
>probe:Drosophila_2:1624307_at:340:453; Interrogation_Position=1323; Antisense; GATCATTGCCATTGGACAGCCGGAA
>probe:Drosophila_2:1624307_at:608:369; Interrogation_Position=1352; Antisense; GAAGGTCGAGACTGGTTCGTCGCAT
>probe:Drosophila_2:1624307_at:389:207; Interrogation_Position=1488; Antisense; AAGCTTTAAGAGATTCCTCCACCGT
>probe:Drosophila_2:1624307_at:655:499; Interrogation_Position=1511; Antisense; GTCTGCACACCAATTCGGATATCTT
>probe:Drosophila_2:1624307_at:202:415; Interrogation_Position=1542; Antisense; GAGCCTGAAGGCTGTGCCCAATAAG
>probe:Drosophila_2:1624307_at:538:215; Interrogation_Position=1564; Antisense; AAGATCACTAACACTTACCGCTGCT
>probe:Drosophila_2:1624307_at:220:27; Interrogation_Position=1591; Antisense; ATAGACGCCAACTTTTGTCCATCAT
>probe:Drosophila_2:1624307_at:56:29; Interrogation_Position=1614; Antisense; ATACAAACGAACCTGTCCCATGGCG
>probe:Drosophila_2:1624307_at:372:67; Interrogation_Position=1633; Antisense; ATGGCGCCATTCTATAGGACGCATT

Paste this into a BLAST search page for me
GAGGATGAGATTTTCTTCGCCGTCTTCGCCGTCTTTCACTGGTTGAATTACTGGTTGAATTACTCCTGGACGGAAGGTTGCGTCGATCCATTTGTAATATACACTTTTGTGTCAGGCGATCATTGGATCATTGCCATTGGACAGCCGGAAGAAGGTCGAGACTGGTTCGTCGCATAAGCTTTAAGAGATTCCTCCACCGTGTCTGCACACCAATTCGGATATCTTGAGCCTGAAGGCTGTGCCCAATAAGAAGATCACTAACACTTACCGCTGCTATAGACGCCAACTTTTGTCCATCATATACAAACGAACCTGTCCCATGGCGATGGCGCCATTCTATAGGACGCATT

Full Affymetrix probeset data:

Annotations for 1624307_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720