Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624308_at:

>probe:Drosophila_2:1624308_at:2:527; Interrogation_Position=1024; Antisense; GGGAGCTCGGCCAGGACTTTGACTA
>probe:Drosophila_2:1624308_at:681:553; Interrogation_Position=1037; Antisense; GGACTTTGACTACGCTTTGTTTTTG
>probe:Drosophila_2:1624308_at:474:279; Interrogation_Position=1046; Antisense; CTACGCTTTGTTTTTGTTATCATCA
>probe:Drosophila_2:1624308_at:25:291; Interrogation_Position=818; Antisense; CGGTCCTGGAGGAGAGCCATGCAAT
>probe:Drosophila_2:1624308_at:717:445; Interrogation_Position=858; Antisense; GATGCACTGTGCCAGGATCTTAACG
>probe:Drosophila_2:1624308_at:195:449; Interrogation_Position=873; Antisense; GATCTTAACGGCGTACTCCGCAATC
>probe:Drosophila_2:1624308_at:212:489; Interrogation_Position=885; Antisense; GTACTCCGCAATCTGGAGCGCAAGA
>probe:Drosophila_2:1624308_at:161:45; Interrogation_Position=909; Antisense; ATCCGTCAATGCGTCTGCGGTGAAC
>probe:Drosophila_2:1624308_at:287:291; Interrogation_Position=926; Antisense; CGGTGAACCGCAATGGTTGCTGTGA
>probe:Drosophila_2:1624308_at:452:361; Interrogation_Position=935; Antisense; GCAATGGTTGCTGTGAAGCGTCGAA
>probe:Drosophila_2:1624308_at:139:119; Interrogation_Position=951; Antisense; AGCGTCGAAGGAGCGTCTAATCCAC
>probe:Drosophila_2:1624308_at:575:655; Interrogation_Position=968; Antisense; TAATCCACTCCCGTACTGATCGATG
>probe:Drosophila_2:1624308_at:42:667; Interrogation_Position=981; Antisense; TACTGATCGATGTGACTGCACCCCT
>probe:Drosophila_2:1624308_at:260:285; Interrogation_Position=996; Antisense; CTGCACCCCTGCGAAATATATTCTG

Paste this into a BLAST search page for me
GGGAGCTCGGCCAGGACTTTGACTAGGACTTTGACTACGCTTTGTTTTTGCTACGCTTTGTTTTTGTTATCATCACGGTCCTGGAGGAGAGCCATGCAATGATGCACTGTGCCAGGATCTTAACGGATCTTAACGGCGTACTCCGCAATCGTACTCCGCAATCTGGAGCGCAAGAATCCGTCAATGCGTCTGCGGTGAACCGGTGAACCGCAATGGTTGCTGTGAGCAATGGTTGCTGTGAAGCGTCGAAAGCGTCGAAGGAGCGTCTAATCCACTAATCCACTCCCGTACTGATCGATGTACTGATCGATGTGACTGCACCCCTCTGCACCCCTGCGAAATATATTCTG

Full Affymetrix probeset data:

Annotations for 1624308_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime