FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624311_at:

>probe:Drosophila_2:1624311_at:648:319; Interrogation_Position=212; Antisense; GCCCCAGCATGTGATCTACCAAAAG
>probe:Drosophila_2:1624311_at:313:183; Interrogation_Position=232; Antisense; AAAAGCAGCACGAGATCCATCCTCA
>probe:Drosophila_2:1624311_at:44:143; Interrogation_Position=256; Antisense; ACGGCCATGAGGTCTATCCCGATGA
>probe:Drosophila_2:1624311_at:25:79; Interrogation_Position=316; Antisense; AGGATGCGCTCTCCGGAGACTCGAA
>probe:Drosophila_2:1624311_at:555:63; Interrogation_Position=367; Antisense; ATGTGGTGCAGGGAGAGTACTCTCT
>probe:Drosophila_2:1624311_at:64:147; Interrogation_Position=385; Antisense; ACTCTCTGGATGATGCTGATGGCTT
>probe:Drosophila_2:1624311_at:573:607; Interrogation_Position=401; Antisense; TGATGGCTTCCGTCGTACTGTAAAA
>probe:Drosophila_2:1624311_at:468:37; Interrogation_Position=417; Antisense; ACTGTAAAATACACCGCCGATTCCG
>probe:Drosophila_2:1624311_at:724:131; Interrogation_Position=429; Antisense; ACCGCCGATTCCGTCAATGGATTTA
>probe:Drosophila_2:1624311_at:112:461; Interrogation_Position=448; Antisense; GATTTAATGCCGTTGTGCACCGCGA
>probe:Drosophila_2:1624311_at:18:583; Interrogation_Position=478; Antisense; TGGCCCATGTGCACCACAAGGTGGT
>probe:Drosophila_2:1624311_at:242:593; Interrogation_Position=499; Antisense; TGGTGGCTGCAGCTCCTGTTCAGTA
>probe:Drosophila_2:1624311_at:192:71; Interrogation_Position=715; Antisense; AGGCCGCCCACGAAGGACATGAGTA
>probe:Drosophila_2:1624311_at:446:73; Interrogation_Position=728; Antisense; AGGACATGAGTACTACCACCACCAG

Paste this into a BLAST search page for me
GCCCCAGCATGTGATCTACCAAAAGAAAAGCAGCACGAGATCCATCCTCAACGGCCATGAGGTCTATCCCGATGAAGGATGCGCTCTCCGGAGACTCGAAATGTGGTGCAGGGAGAGTACTCTCTACTCTCTGGATGATGCTGATGGCTTTGATGGCTTCCGTCGTACTGTAAAAACTGTAAAATACACCGCCGATTCCGACCGCCGATTCCGTCAATGGATTTAGATTTAATGCCGTTGTGCACCGCGATGGCCCATGTGCACCACAAGGTGGTTGGTGGCTGCAGCTCCTGTTCAGTAAGGCCGCCCACGAAGGACATGAGTAAGGACATGAGTACTACCACCACCAG

Full Affymetrix probeset data:

Annotations for 1624311_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720