FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624313_at:

>probe:Drosophila_2:1624313_at:107:541; Interrogation_Position=1001; Antisense; GGTTGAATAATTCGACTCCCTGTGA
>probe:Drosophila_2:1624313_at:187:369; Interrogation_Position=1024; Antisense; GAATGCAACACCACCTAATCGAGGG
>probe:Drosophila_2:1624313_at:572:653; Interrogation_Position=1039; Antisense; TAATCGAGGGCCACAACAATCCAAC
>probe:Drosophila_2:1624313_at:456:47; Interrogation_Position=1057; Antisense; ATCCAACCGACTTTGATTTATCGAG
>probe:Drosophila_2:1624313_at:165:357; Interrogation_Position=1097; Antisense; GCAACTAGTCCTTGGTTGATTACCA
>probe:Drosophila_2:1624313_at:231:29; Interrogation_Position=1153; Antisense; ATACGAATACTCTCTTCTCTCTATC
>probe:Drosophila_2:1624313_at:683:643; Interrogation_Position=1170; Antisense; TCTCTATCACTCTGTCTCTATTTGA
>probe:Drosophila_2:1624313_at:14:579; Interrogation_Position=1207; Antisense; GGCCGCGGCCAGAAGGAGACTCCAT
>probe:Drosophila_2:1624313_at:725:227; Interrogation_Position=1240; Antisense; AATGGAGGATCCTGTGGACCTGACG
>probe:Drosophila_2:1624313_at:508:567; Interrogation_Position=1268; Antisense; GGCAGCGCATAATCACCGCATGTGT
>probe:Drosophila_2:1624313_at:230:499; Interrogation_Position=1300; Antisense; GTCTCGTCGCAAGTCCTTAATATAG
>probe:Drosophila_2:1624313_at:119:387; Interrogation_Position=1330; Antisense; GAAAAGCTCGCCTCTAAACAGTGCC
>probe:Drosophila_2:1624313_at:672:149; Interrogation_Position=869; Antisense; ACTTCGTGTGTACTTGTGTTGTGTA
>probe:Drosophila_2:1624313_at:587:33; Interrogation_Position=968; Antisense; ATCAAGGCTCATTCTACTTATCAGA

Paste this into a BLAST search page for me
GGTTGAATAATTCGACTCCCTGTGAGAATGCAACACCACCTAATCGAGGGTAATCGAGGGCCACAACAATCCAACATCCAACCGACTTTGATTTATCGAGGCAACTAGTCCTTGGTTGATTACCAATACGAATACTCTCTTCTCTCTATCTCTCTATCACTCTGTCTCTATTTGAGGCCGCGGCCAGAAGGAGACTCCATAATGGAGGATCCTGTGGACCTGACGGGCAGCGCATAATCACCGCATGTGTGTCTCGTCGCAAGTCCTTAATATAGGAAAAGCTCGCCTCTAAACAGTGCCACTTCGTGTGTACTTGTGTTGTGTAATCAAGGCTCATTCTACTTATCAGA

Full Affymetrix probeset data:

Annotations for 1624313_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720