Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624315_at:

>probe:Drosophila_2:1624315_at:159:497; Interrogation_Position=103; Antisense; GTCATCCATGGAATGCCCGGCGCCT
>probe:Drosophila_2:1624315_at:153:87; Interrogation_Position=133; Antisense; AGTGCCACGCCCGAGGGCGGTACTC
>probe:Drosophila_2:1624315_at:27:593; Interrogation_Position=14; Antisense; TGGTGGACGACATCTCACCGATGCA
>probe:Drosophila_2:1624315_at:21:557; Interrogation_Position=18; Antisense; GGACGACATCTCACCGATGCATCAT
>probe:Drosophila_2:1624315_at:661:401; Interrogation_Position=22; Antisense; GACATCTCACCGATGCATCATCGGA
>probe:Drosophila_2:1624315_at:246:37; Interrogation_Position=25; Antisense; ATCTCACCGATGCATCATCGGATGC
>probe:Drosophila_2:1624315_at:94:647; Interrogation_Position=39; Antisense; TCATCGGATGCAAAAGAAGACGCGC
>probe:Drosophila_2:1624315_at:23:55; Interrogation_Position=46; Antisense; ATGCAAAAGAAGACGCGCAGCGCCT
>probe:Drosophila_2:1624315_at:449:109; Interrogation_Position=53; Antisense; AGAAGACGCGCAGCGCCTCCATTTG
>probe:Drosophila_2:1624315_at:341:629; Interrogation_Position=70; Antisense; TCCATTTGTGCCACCGGCGCCAGCA
>probe:Drosophila_2:1624315_at:223:323; Interrogation_Position=86; Antisense; GCGCCAGCATCGAGACGGTCATCCA
>probe:Drosophila_2:1624315_at:66:117; Interrogation_Position=91; Antisense; AGCATCGAGACGGTCATCCATGGAA
>probe:Drosophila_2:1624315_at:616:43; Interrogation_Position=94; Antisense; ATCGAGACGGTCATCCATGGAATGC
>probe:Drosophila_2:1624315_at:277:407; Interrogation_Position=99; Antisense; GACGGTCATCCATGGAATGCCCGGC

Paste this into a BLAST search page for me
GTCATCCATGGAATGCCCGGCGCCTAGTGCCACGCCCGAGGGCGGTACTCTGGTGGACGACATCTCACCGATGCAGGACGACATCTCACCGATGCATCATGACATCTCACCGATGCATCATCGGAATCTCACCGATGCATCATCGGATGCTCATCGGATGCAAAAGAAGACGCGCATGCAAAAGAAGACGCGCAGCGCCTAGAAGACGCGCAGCGCCTCCATTTGTCCATTTGTGCCACCGGCGCCAGCAGCGCCAGCATCGAGACGGTCATCCAAGCATCGAGACGGTCATCCATGGAAATCGAGACGGTCATCCATGGAATGCGACGGTCATCCATGGAATGCCCGGC

Full Affymetrix probeset data:

Annotations for 1624315_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime