Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624316_at:

>probe:Drosophila_2:1624316_at:672:251; Interrogation_Position=1067; Antisense; CAAGCTAAAGCTGCGCATTCCGTAC
>probe:Drosophila_2:1624316_at:34:345; Interrogation_Position=1081; Antisense; GCATTCCGTACGTCTCCAATGAGAA
>probe:Drosophila_2:1624316_at:594:383; Interrogation_Position=1103; Antisense; GAACTGCACCAAGATTCTCGAGGGA
>probe:Drosophila_2:1624316_at:435:461; Interrogation_Position=1126; Antisense; GATTCGGAGTGCGATTGGGTCCCAA
>probe:Drosophila_2:1624316_at:661:369; Interrogation_Position=1178; Antisense; GAAGGACACGTGTGCCGGCGACTCC
>probe:Drosophila_2:1624316_at:504:533; Interrogation_Position=1203; Antisense; GGTGGACCTCTGATGTACTTCGATA
>probe:Drosophila_2:1624316_at:99:669; Interrogation_Position=1218; Antisense; TACTTCGATAGACAGCACTCCCGGT
>probe:Drosophila_2:1624316_at:498:665; Interrogation_Position=1251; Antisense; TACGGCGTGGTCAGCTACGGATTTA
>probe:Drosophila_2:1624316_at:289:709; Interrogation_Position=1273; Antisense; TTACACAGTGCGGTATGGCCGGTAA
>probe:Drosophila_2:1624316_at:637:489; Interrogation_Position=1294; Antisense; GTAAGCCGGCTGTTTATACTAACGT
>probe:Drosophila_2:1624316_at:509:521; Interrogation_Position=1317; Antisense; GTGGCCGAATACACGGACTGGATCG
>probe:Drosophila_2:1624316_at:234:589; Interrogation_Position=1335; Antisense; TGGATCGACAGTGTTGTGCAGCAGA
>probe:Drosophila_2:1624316_at:679:227; Interrogation_Position=1388; Antisense; AATGGCTTGACGTCAGATTTCTTTA
>probe:Drosophila_2:1624316_at:55:465; Interrogation_Position=1454; Antisense; GATTCCGATTCAGATATGTTTACCT

Paste this into a BLAST search page for me
CAAGCTAAAGCTGCGCATTCCGTACGCATTCCGTACGTCTCCAATGAGAAGAACTGCACCAAGATTCTCGAGGGAGATTCGGAGTGCGATTGGGTCCCAAGAAGGACACGTGTGCCGGCGACTCCGGTGGACCTCTGATGTACTTCGATATACTTCGATAGACAGCACTCCCGGTTACGGCGTGGTCAGCTACGGATTTATTACACAGTGCGGTATGGCCGGTAAGTAAGCCGGCTGTTTATACTAACGTGTGGCCGAATACACGGACTGGATCGTGGATCGACAGTGTTGTGCAGCAGAAATGGCTTGACGTCAGATTTCTTTAGATTCCGATTCAGATATGTTTACCT

Full Affymetrix probeset data:

Annotations for 1624316_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime