FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624318_at:

>probe:Drosophila_2:1624318_at:426:417; Interrogation_Position=1049; Antisense; GAGCGCACCAGCATTGAGGATTTCT
>probe:Drosophila_2:1624318_at:656:459; Interrogation_Position=1067; Antisense; GATTTCTGCAACAAGCTGCATCGCT
>probe:Drosophila_2:1624318_at:457:347; Interrogation_Position=1084; Antisense; GCATCGCTCCATTGCCAAGGAATTT
>probe:Drosophila_2:1624318_at:4:373; Interrogation_Position=1207; Antisense; GAAGGTTTAGACTCTGTGCAACGAT
>probe:Drosophila_2:1624318_at:320:531; Interrogation_Position=721; Antisense; GGTGAAGACCATTCTATCCGAGTAC
>probe:Drosophila_2:1624318_at:221:51; Interrogation_Position=756; Antisense; ATGCGGACATCACCCTGAGATACGA
>probe:Drosophila_2:1624318_at:22:429; Interrogation_Position=772; Antisense; GAGATACGACGCCACTAGTGACGAC
>probe:Drosophila_2:1624318_at:599:511; Interrogation_Position=789; Antisense; GTGACGACCTCATTGACGTTATCGA
>probe:Drosophila_2:1624318_at:648:475; Interrogation_Position=806; Antisense; GTTATCGAGGGCAACCGCATCTACA
>probe:Drosophila_2:1624318_at:599:151; Interrogation_Position=828; Antisense; ACATACCCTGCATATATCTGCTGAA
>probe:Drosophila_2:1624318_at:384:43; Interrogation_Position=872; Antisense; ATCGAGGAGCTGGACGTCATCTACA
>probe:Drosophila_2:1624318_at:474:647; Interrogation_Position=888; Antisense; TCATCTACAAGATCCCGCATTGCGT
>probe:Drosophila_2:1624318_at:337:261; Interrogation_Position=929; Antisense; CACCACTGGAACTTTGACGATCTGC
>probe:Drosophila_2:1624318_at:652:63; Interrogation_Position=962; Antisense; ATGTGGGAATACCTGCGACTGCAGC

Paste this into a BLAST search page for me
GAGCGCACCAGCATTGAGGATTTCTGATTTCTGCAACAAGCTGCATCGCTGCATCGCTCCATTGCCAAGGAATTTGAAGGTTTAGACTCTGTGCAACGATGGTGAAGACCATTCTATCCGAGTACATGCGGACATCACCCTGAGATACGAGAGATACGACGCCACTAGTGACGACGTGACGACCTCATTGACGTTATCGAGTTATCGAGGGCAACCGCATCTACAACATACCCTGCATATATCTGCTGAAATCGAGGAGCTGGACGTCATCTACATCATCTACAAGATCCCGCATTGCGTCACCACTGGAACTTTGACGATCTGCATGTGGGAATACCTGCGACTGCAGC

Full Affymetrix probeset data:

Annotations for 1624318_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720