Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624319_at:

>probe:Drosophila_2:1624319_at:679:115; Interrogation_Position=5998; Antisense; AGCATATCAACAACTTCACCAACAC
>probe:Drosophila_2:1624319_at:160:259; Interrogation_Position=6020; Antisense; CACAGTATGCATTAACGAGTTCCAC
>probe:Drosophila_2:1624319_at:695:137; Interrogation_Position=6034; Antisense; ACGAGTTCCACACCAAATACTTCAA
>probe:Drosophila_2:1624319_at:416:709; Interrogation_Position=6054; Antisense; TTCAACAACATCACATTCTTCTACC
>probe:Drosophila_2:1624319_at:457:643; Interrogation_Position=6073; Antisense; TCTACCCCATCCTCAATAAATAATC
>probe:Drosophila_2:1624319_at:568:239; Interrogation_Position=6118; Antisense; AATCACCAGCCAATTGTAGACGCAA
>probe:Drosophila_2:1624319_at:205:161; Interrogation_Position=6215; Antisense; AAATTCTTCAACTTCTTAATGGCAA
>probe:Drosophila_2:1624319_at:137:45; Interrogation_Position=6233; Antisense; ATGGCAAACCAATAGATCGGCGGAC
>probe:Drosophila_2:1624319_at:403:451; Interrogation_Position=6247; Antisense; GATCGGCGGACAAAAACTATTGCTA
>probe:Drosophila_2:1624319_at:276:91; Interrogation_Position=6396; Antisense; AGATAGTCACATCCCTAAACCGATT
>probe:Drosophila_2:1624319_at:300:599; Interrogation_Position=6450; Antisense; TGTCCCATTAAAACTATCTGCTATT
>probe:Drosophila_2:1624319_at:162:533; Interrogation_Position=6484; Antisense; GGTGGACTAAAACATTTGCCTTCAA
>probe:Drosophila_2:1624319_at:384:231; Interrogation_Position=6537; Antisense; AATGCATGAGATTTTCCCGGAACCC
>probe:Drosophila_2:1624319_at:580:561; Interrogation_Position=6555; Antisense; GGAACCCGTATCAATACTGCCACAT

Paste this into a BLAST search page for me
AGCATATCAACAACTTCACCAACACCACAGTATGCATTAACGAGTTCCACACGAGTTCCACACCAAATACTTCAATTCAACAACATCACATTCTTCTACCTCTACCCCATCCTCAATAAATAATCAATCACCAGCCAATTGTAGACGCAAAAATTCTTCAACTTCTTAATGGCAAATGGCAAACCAATAGATCGGCGGACGATCGGCGGACAAAAACTATTGCTAAGATAGTCACATCCCTAAACCGATTTGTCCCATTAAAACTATCTGCTATTGGTGGACTAAAACATTTGCCTTCAAAATGCATGAGATTTTCCCGGAACCCGGAACCCGTATCAATACTGCCACAT

Full Affymetrix probeset data:

Annotations for 1624319_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime