Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624320_at:

>probe:Drosophila_2:1624320_at:537:545; Interrogation_Position=3029; Antisense; GGATCGCACAATCGCTTCAGGATGG
>probe:Drosophila_2:1624320_at:168:447; Interrogation_Position=3084; Antisense; GATGCTCTCCAGCAAGGATGGACCT
>probe:Drosophila_2:1624320_at:13:525; Interrogation_Position=3125; Antisense; GGGCGACAGAACAACCAGAACTCTC
>probe:Drosophila_2:1624320_at:524:145; Interrogation_Position=3144; Antisense; ACTCTCTCCGGCTCTGAAGAGTTGA
>probe:Drosophila_2:1624320_at:364:467; Interrogation_Position=3164; Antisense; GTTGAGCACACAGACAGCGCACAAT
>probe:Drosophila_2:1624320_at:698:607; Interrogation_Position=3261; Antisense; TGAGTGACTGACTGTCTGGTCGCCA
>probe:Drosophila_2:1624320_at:653:641; Interrogation_Position=3275; Antisense; TCTGGTCGCCAGACAACGTTGACAA
>probe:Drosophila_2:1624320_at:30:397; Interrogation_Position=3295; Antisense; GACAATCGGGAAACTGGCGCTGACC
>probe:Drosophila_2:1624320_at:479:529; Interrogation_Position=3324; Antisense; GGGATGCGCACACACTGCAGCCAGT
>probe:Drosophila_2:1624320_at:636:347; Interrogation_Position=3458; Antisense; GCAGGACCTTCCATATGACAGAACG
>probe:Drosophila_2:1624320_at:554:133; Interrogation_Position=3480; Antisense; ACGAACACCTGCAGCGTTGAAAAGC
>probe:Drosophila_2:1624320_at:412:15; Interrogation_Position=3518; Antisense; ATTTTGTATCCACCAGCAGAGGCGT
>probe:Drosophila_2:1624320_at:629:349; Interrogation_Position=3533; Antisense; GCAGAGGCGTTCCAGTGAAATCTAT
>probe:Drosophila_2:1624320_at:668:171; Interrogation_Position=3559; Antisense; AAAGAAACTCGTGTCAATGTCCCCA

Paste this into a BLAST search page for me
GGATCGCACAATCGCTTCAGGATGGGATGCTCTCCAGCAAGGATGGACCTGGGCGACAGAACAACCAGAACTCTCACTCTCTCCGGCTCTGAAGAGTTGAGTTGAGCACACAGACAGCGCACAATTGAGTGACTGACTGTCTGGTCGCCATCTGGTCGCCAGACAACGTTGACAAGACAATCGGGAAACTGGCGCTGACCGGGATGCGCACACACTGCAGCCAGTGCAGGACCTTCCATATGACAGAACGACGAACACCTGCAGCGTTGAAAAGCATTTTGTATCCACCAGCAGAGGCGTGCAGAGGCGTTCCAGTGAAATCTATAAAGAAACTCGTGTCAATGTCCCCA

Full Affymetrix probeset data:

Annotations for 1624320_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime