Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624321_at:

>probe:Drosophila_2:1624321_at:30:127; Interrogation_Position=1024; Antisense; ACCAAACTGGATCTGCGCGACGATA
>probe:Drosophila_2:1624321_at:171:211; Interrogation_Position=1075; Antisense; AAGAAGCTAACACCGATCACCTATC
>probe:Drosophila_2:1624321_at:191:47; Interrogation_Position=1097; Antisense; ATCCCCAAGGACTGGCGATGGCCAA
>probe:Drosophila_2:1624321_at:178:375; Interrogation_Position=1176; Antisense; GAAGACGGTCTTCGACGAGGCCATA
>probe:Drosophila_2:1624321_at:346:439; Interrogation_Position=1192; Antisense; GAGGCCATACGATCCGTGCTATGTC
>probe:Drosophila_2:1624321_at:195:681; Interrogation_Position=1211; Antisense; TATGTCCTGTCGTTCGAGGACCCAA
>probe:Drosophila_2:1624321_at:380:625; Interrogation_Position=1246; Antisense; TGCGCCCTGCTCTAAGAACTTTGAA
>probe:Drosophila_2:1624321_at:141:515; Interrogation_Position=787; Antisense; GTGTTCGACAACTATTCGGCGAATG
>probe:Drosophila_2:1624321_at:436:237; Interrogation_Position=835; Antisense; AATCTGGGCCTCTGGGATACGGCTG
>probe:Drosophila_2:1624321_at:145:359; Interrogation_Position=900; Antisense; GCAAACGGATGTCTTTCTCATCTGT
>probe:Drosophila_2:1624321_at:59:715; Interrogation_Position=914; Antisense; TTCTCATCTGTTTCTCACTGGTGAA
>probe:Drosophila_2:1624321_at:453:127; Interrogation_Position=963; Antisense; AGCCAAATGGTTTCCCGAGGTGCGT
>probe:Drosophila_2:1624321_at:127:81; Interrogation_Position=980; Antisense; AGGTGCGTCATCATTGCCCGAGTGT
>probe:Drosophila_2:1624321_at:74:723; Interrogation_Position=993; Antisense; TTGCCCGAGTGTGCCGATAATCCTG

Paste this into a BLAST search page for me
ACCAAACTGGATCTGCGCGACGATAAAGAAGCTAACACCGATCACCTATCATCCCCAAGGACTGGCGATGGCCAAGAAGACGGTCTTCGACGAGGCCATAGAGGCCATACGATCCGTGCTATGTCTATGTCCTGTCGTTCGAGGACCCAATGCGCCCTGCTCTAAGAACTTTGAAGTGTTCGACAACTATTCGGCGAATGAATCTGGGCCTCTGGGATACGGCTGGCAAACGGATGTCTTTCTCATCTGTTTCTCATCTGTTTCTCACTGGTGAAAGCCAAATGGTTTCCCGAGGTGCGTAGGTGCGTCATCATTGCCCGAGTGTTTGCCCGAGTGTGCCGATAATCCTG

Full Affymetrix probeset data:

Annotations for 1624321_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime