Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624322_at:

>probe:Drosophila_2:1624322_at:202:535; Interrogation_Position=1253; Antisense; GGTGCTCGGCTATCGCTATTTAACA
>probe:Drosophila_2:1624322_at:681:695; Interrogation_Position=1271; Antisense; TTTAACACCCTGGATGACGGCCAAT
>probe:Drosophila_2:1624322_at:624:237; Interrogation_Position=1293; Antisense; AATCTGAGGCTGCACGACACCTGTG
>probe:Drosophila_2:1624322_at:62:525; Interrogation_Position=1394; Antisense; GGGCGAGTACCAATCCGAGCTGCAG
>probe:Drosophila_2:1624322_at:447:347; Interrogation_Position=1415; Antisense; GCAGGACATTTTCCCGGCCATGGTG
>probe:Drosophila_2:1624322_at:424:165; Interrogation_Position=1462; Antisense; AAATCATGGGCGGTCTTGGCCGGAA
>probe:Drosophila_2:1624322_at:310:635; Interrogation_Position=1494; Antisense; TCGCAGGCGGGCTACCAATTGTTTG
>probe:Drosophila_2:1624322_at:37:249; Interrogation_Position=1510; Antisense; AATTGTTTGGCATCGCTGTCACACT
>probe:Drosophila_2:1624322_at:120:157; Interrogation_Position=1530; Antisense; ACACTGCTCATTGCCATCGGAGGTG
>probe:Drosophila_2:1624322_at:610:133; Interrogation_Position=1624; Antisense; ACGAGCACTACTGGGAAGTTCCGGC
>probe:Drosophila_2:1624322_at:317:93; Interrogation_Position=1669; Antisense; AGTTAAGTGTTGTGCCTGTCAGATT
>probe:Drosophila_2:1624322_at:362:465; Interrogation_Position=1690; Antisense; GATTGATCACAGTTCACGCGACTCT
>probe:Drosophila_2:1624322_at:339:325; Interrogation_Position=1707; Antisense; GCGACTCTAATGTGCCTTGTCTAAC
>probe:Drosophila_2:1624322_at:184:279; Interrogation_Position=1726; Antisense; TCTAACTACTTACGACTACCTTACT

Paste this into a BLAST search page for me
GGTGCTCGGCTATCGCTATTTAACATTTAACACCCTGGATGACGGCCAATAATCTGAGGCTGCACGACACCTGTGGGGCGAGTACCAATCCGAGCTGCAGGCAGGACATTTTCCCGGCCATGGTGAAATCATGGGCGGTCTTGGCCGGAATCGCAGGCGGGCTACCAATTGTTTGAATTGTTTGGCATCGCTGTCACACTACACTGCTCATTGCCATCGGAGGTGACGAGCACTACTGGGAAGTTCCGGCAGTTAAGTGTTGTGCCTGTCAGATTGATTGATCACAGTTCACGCGACTCTGCGACTCTAATGTGCCTTGTCTAACTCTAACTACTTACGACTACCTTACT

Full Affymetrix probeset data:

Annotations for 1624322_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime