FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624323_at:

>probe:Drosophila_2:1624323_at:516:235; Interrogation_Position=107; Antisense; AATCTGAGGAGACTTTTAAATACTT
>probe:Drosophila_2:1624323_at:8:181; Interrogation_Position=133; Antisense; AAAAACGCAGCATTGGAGGTCATTG
>probe:Drosophila_2:1624323_at:533:297; Interrogation_Position=138; Antisense; CGCAGCATTGGAGGTCATTGACGTC
>probe:Drosophila_2:1624323_at:448:433; Interrogation_Position=148; Antisense; GAGGTCATTGACGTCGGCCAAAAAG
>probe:Drosophila_2:1624323_at:268:497; Interrogation_Position=160; Antisense; GTCGGCCAAAAAGCCGCGGATTTTG
>probe:Drosophila_2:1624323_at:64:253; Interrogation_Position=166; Antisense; CAAAAAGCCGCGGATTTTGCTGCCA
>probe:Drosophila_2:1624323_at:282:693; Interrogation_Position=181; Antisense; TTTGCTGCCATTGCCAGGGGACAGA
>probe:Drosophila_2:1624323_at:51:701; Interrogation_Position=31; Antisense; TTTTTGTTTGCTTTCATCATCCTGA
>probe:Drosophila_2:1624323_at:170:481; Interrogation_Position=36; Antisense; GTTTGCTTTCATCATCCTGACAATT
>probe:Drosophila_2:1624323_at:663:711; Interrogation_Position=43; Antisense; TTCATCATCCTGACAATTAACTTGC
>probe:Drosophila_2:1624323_at:445:245; Interrogation_Position=57; Antisense; AATTAACTTGCAACACTCGCATGCC
>probe:Drosophila_2:1624323_at:390:191; Interrogation_Position=61; Antisense; AACTTGCAACACTCGCATGCCGGTT
>probe:Drosophila_2:1624323_at:367:255; Interrogation_Position=67; Antisense; CAACACTCGCATGCCGGTTGGCTGA
>probe:Drosophila_2:1624323_at:711:297; Interrogation_Position=74; Antisense; CGCATGCCGGTTGGCTGACGGATAT

Paste this into a BLAST search page for me
AATCTGAGGAGACTTTTAAATACTTAAAAACGCAGCATTGGAGGTCATTGCGCAGCATTGGAGGTCATTGACGTCGAGGTCATTGACGTCGGCCAAAAAGGTCGGCCAAAAAGCCGCGGATTTTGCAAAAAGCCGCGGATTTTGCTGCCATTTGCTGCCATTGCCAGGGGACAGATTTTTGTTTGCTTTCATCATCCTGAGTTTGCTTTCATCATCCTGACAATTTTCATCATCCTGACAATTAACTTGCAATTAACTTGCAACACTCGCATGCCAACTTGCAACACTCGCATGCCGGTTCAACACTCGCATGCCGGTTGGCTGACGCATGCCGGTTGGCTGACGGATAT

Full Affymetrix probeset data:

Annotations for 1624323_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720