FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624325_at:

>probe:Drosophila_2:1624325_at:101:595; Interrogation_Position=1005; Antisense; TGGGCGATCATAGGCGGCAGTCACT
>probe:Drosophila_2:1624325_at:344:89; Interrogation_Position=1023; Antisense; AGTCACTGTATCTCTGCGGTCAGAA
>probe:Drosophila_2:1624325_at:534:107; Interrogation_Position=1044; Antisense; AGAACATGGCGGTGTGCATGCCCTT
>probe:Drosophila_2:1624325_at:348:541; Interrogation_Position=1141; Antisense; GGATACGAACACCACGTTGTCGGTT
>probe:Drosophila_2:1624325_at:210:529; Interrogation_Position=1171; Antisense; GGGTTATATACCACGGTTCTTCAGT
>probe:Drosophila_2:1624325_at:644:311; Interrogation_Position=1199; Antisense; GCCAAGGACCAGTACTACGCGTTGA
>probe:Drosophila_2:1624325_at:684:149; Interrogation_Position=1245; Antisense; ACAGGAATACCTACAGACCCAGTCT
>probe:Drosophila_2:1624325_at:288:73; Interrogation_Position=1278; Antisense; AGGCAAGGGCCGTACTCAGCCAGAA
>probe:Drosophila_2:1624325_at:288:429; Interrogation_Position=1319; Antisense; GAGTTGTATCAGTTCGTCAGGCACC
>probe:Drosophila_2:1624325_at:100:649; Interrogation_Position=1335; Antisense; TCAGGCACCGGCTGTACAAGCAGTA
>probe:Drosophila_2:1624325_at:157:427; Interrogation_Position=816; Antisense; GAGATCCCATCGAGCGGCTGGTCAG
>probe:Drosophila_2:1624325_at:282:627; Interrogation_Position=901; Antisense; TGCCATCGTACTGCCTAGCATAGAT
>probe:Drosophila_2:1624325_at:404:563; Interrogation_Position=933; Antisense; GGAAGGACTTTAACCGCTGCATCGA
>probe:Drosophila_2:1624325_at:119:201; Interrogation_Position=960; Antisense; AACGCGATCCCGAGTGTGTGTACGA

Paste this into a BLAST search page for me
TGGGCGATCATAGGCGGCAGTCACTAGTCACTGTATCTCTGCGGTCAGAAAGAACATGGCGGTGTGCATGCCCTTGGATACGAACACCACGTTGTCGGTTGGGTTATATACCACGGTTCTTCAGTGCCAAGGACCAGTACTACGCGTTGAACAGGAATACCTACAGACCCAGTCTAGGCAAGGGCCGTACTCAGCCAGAAGAGTTGTATCAGTTCGTCAGGCACCTCAGGCACCGGCTGTACAAGCAGTAGAGATCCCATCGAGCGGCTGGTCAGTGCCATCGTACTGCCTAGCATAGATGGAAGGACTTTAACCGCTGCATCGAAACGCGATCCCGAGTGTGTGTACGA

Full Affymetrix probeset data:

Annotations for 1624325_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720