FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624326_at:

>probe:Drosophila_2:1624326_at:614:559; Interrogation_Position=1531; Antisense; GGAAATTATCTCGATGCCAACTATA
>probe:Drosophila_2:1624326_at:242:221; Interrogation_Position=1656; Antisense; AAGTGACTATGCAATATCGGTATAT
>probe:Drosophila_2:1624326_at:41:95; Interrogation_Position=1699; Antisense; AGTTGATTGTAACGCTAGTAGCTAA
>probe:Drosophila_2:1624326_at:198:663; Interrogation_Position=1729; Antisense; TAAAGTTGGCGTTACACATCGATCA
>probe:Drosophila_2:1624326_at:217:153; Interrogation_Position=1744; Antisense; ACATCGATCAGCAAGTCCAAACTAT
>probe:Drosophila_2:1624326_at:43:169; Interrogation_Position=1844; Antisense; AAAGGTTTTGCTACACTTGGCTTCT
>probe:Drosophila_2:1624326_at:137:703; Interrogation_Position=1849; Antisense; TTTTGCTACACTTGGCTTCTCTGCA
>probe:Drosophila_2:1624326_at:400:715; Interrogation_Position=1865; Antisense; TTCTCTGCACCTCTACAAGTGTTTT
>probe:Drosophila_2:1624326_at:656:477; Interrogation_Position=1885; Antisense; GTTTTATTTTTGTATGGGCCATGTA
>probe:Drosophila_2:1624326_at:504:485; Interrogation_Position=1896; Antisense; GTATGGGCCATGTATTCAAGAGCCA
>probe:Drosophila_2:1624326_at:419:649; Interrogation_Position=1911; Antisense; TCAAGAGCCAAATCGTCGGTTTTAT
>probe:Drosophila_2:1624326_at:116:497; Interrogation_Position=1925; Antisense; GTCGGTTTTATTTCCATCGATATTG
>probe:Drosophila_2:1624326_at:664:603; Interrogation_Position=1973; Antisense; TGATTTGACTTCTTTATTTACTAAA
>probe:Drosophila_2:1624326_at:117:61; Interrogation_Position=2072; Antisense; ATGTGCAGAACGTTCGTATGCATAC

Paste this into a BLAST search page for me
GGAAATTATCTCGATGCCAACTATAAAGTGACTATGCAATATCGGTATATAGTTGATTGTAACGCTAGTAGCTAATAAAGTTGGCGTTACACATCGATCAACATCGATCAGCAAGTCCAAACTATAAAGGTTTTGCTACACTTGGCTTCTTTTTGCTACACTTGGCTTCTCTGCATTCTCTGCACCTCTACAAGTGTTTTGTTTTATTTTTGTATGGGCCATGTAGTATGGGCCATGTATTCAAGAGCCATCAAGAGCCAAATCGTCGGTTTTATGTCGGTTTTATTTCCATCGATATTGTGATTTGACTTCTTTATTTACTAAAATGTGCAGAACGTTCGTATGCATAC

Full Affymetrix probeset data:

Annotations for 1624326_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720