Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624327_at:

>probe:Drosophila_2:1624327_at:345:425; Interrogation_Position=3066; Antisense; GAGACGCAGCTTGTTTAGAGATTTA
>probe:Drosophila_2:1624327_at:142:699; Interrogation_Position=3087; Antisense; TTTAGAGATGTTTTCCATGTCGGGA
>probe:Drosophila_2:1624327_at:703:265; Interrogation_Position=3102; Antisense; CATGTCGGGAGTAGCCCTTCGGAAA
>probe:Drosophila_2:1624327_at:483:165; Interrogation_Position=3251; Antisense; AAATCTATCAAGCTTTCCATTCCAC
>probe:Drosophila_2:1624327_at:562:277; Interrogation_Position=3263; Antisense; CTTTCCATTCCACCCAATATTTTAT
>probe:Drosophila_2:1624327_at:358:413; Interrogation_Position=3289; Antisense; GACCTATAATCTGCATTTCCTTGGG
>probe:Drosophila_2:1624327_at:287:543; Interrogation_Position=3372; Antisense; GGATATTTCCCTATGGGCTGTTCCA
>probe:Drosophila_2:1624327_at:630:523; Interrogation_Position=3386; Antisense; GGGCTGTTCCATTTTTATAGAGCTC
>probe:Drosophila_2:1624327_at:138:419; Interrogation_Position=3405; Antisense; GAGCTCTACCCTATCGCAGGTAAAA
>probe:Drosophila_2:1624327_at:311:403; Interrogation_Position=3437; Antisense; GACTTTCCCTTAGTTTTCAGCAACT
>probe:Drosophila_2:1624327_at:260:479; Interrogation_Position=3468; Antisense; GTTTACTGGTGCGACAACAGGTGCA
>probe:Drosophila_2:1624327_at:690:107; Interrogation_Position=3542; Antisense; AGAACCATCAATCACGTGCGGACTC
>probe:Drosophila_2:1624327_at:421:621; Interrogation_Position=3558; Antisense; TGCGGACTCGCAAAGCCAAAGCCAA
>probe:Drosophila_2:1624327_at:232:175; Interrogation_Position=3575; Antisense; AAAGCCAACTTAACCATATGCCAAA

Paste this into a BLAST search page for me
GAGACGCAGCTTGTTTAGAGATTTATTTAGAGATGTTTTCCATGTCGGGACATGTCGGGAGTAGCCCTTCGGAAAAAATCTATCAAGCTTTCCATTCCACCTTTCCATTCCACCCAATATTTTATGACCTATAATCTGCATTTCCTTGGGGGATATTTCCCTATGGGCTGTTCCAGGGCTGTTCCATTTTTATAGAGCTCGAGCTCTACCCTATCGCAGGTAAAAGACTTTCCCTTAGTTTTCAGCAACTGTTTACTGGTGCGACAACAGGTGCAAGAACCATCAATCACGTGCGGACTCTGCGGACTCGCAAAGCCAAAGCCAAAAAGCCAACTTAACCATATGCCAAA

Full Affymetrix probeset data:

Annotations for 1624327_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime